CRAN Package Check Results for Package crispRdesignR

Last updated on 2022-12-03 07:09:46 CET.

Flavor Version Tinstall Tcheck Ttotal Status Flags
r-devel-linux-x86_64-debian-clang 1.1.6 5.05 63.33 68.38 NOTE
r-devel-linux-x86_64-debian-gcc 1.1.6 4.46 46.91 51.37 NOTE
r-devel-linux-x86_64-fedora-clang 1.1.6 87.74 ERROR
r-devel-linux-x86_64-fedora-gcc 1.1.6 83.82 ERROR
r-devel-windows-x86_64 1.1.6 22.00 88.00 110.00 NOTE
r-patched-linux-x86_64 1.1.6 5.31 59.78 65.09 NOTE
r-release-linux-x86_64 1.1.6 6.21 58.08 64.29 NOTE
r-release-macos-arm64 1.1.6 27.00 NOTE
r-release-macos-x86_64 1.1.6 49.00 NOTE
r-release-windows-x86_64 1.1.6 14.00 92.00 106.00 NOTE
r-oldrel-macos-arm64 1.1.6 35.00 NOTE
r-oldrel-macos-x86_64 1.1.6 49.00 NOTE
r-oldrel-windows-ix86+x86_64 1.1.6 13.00 83.00 96.00 NOTE

Check Details

Version: 1.1.6
Check: LazyData
Result: NOTE
     'LazyData' is specified without a 'data' directory
Flavors: r-devel-linux-x86_64-debian-clang, r-devel-linux-x86_64-debian-gcc, r-devel-linux-x86_64-fedora-clang, r-devel-linux-x86_64-fedora-gcc, r-devel-windows-x86_64, r-patched-linux-x86_64, r-release-linux-x86_64, r-release-macos-arm64, r-release-macos-x86_64, r-release-windows-x86_64, r-oldrel-macos-arm64, r-oldrel-macos-x86_64, r-oldrel-windows-ix86+x86_64

Version: 1.1.6
Check: dependencies in R code
Result: NOTE
    Namespaces in Imports field not imported from:
     ‘DT’ ‘gbm’
     All declared Imports should be used.
Flavors: r-devel-linux-x86_64-fedora-clang, r-devel-linux-x86_64-fedora-gcc, r-release-macos-arm64, r-release-macos-x86_64, r-oldrel-macos-arm64, r-oldrel-macos-x86_64

Version: 1.1.6
Check: examples
Result: ERROR
    Running examples in ‘crispRdesignR-Ex.R’ failed
    The error most likely occurred in:
    
    > ### Name: getofftargetdata
    > ### Title: Off Target Data Frame Creation
    > ### Aliases: getofftargetdata
    >
    > ### ** Examples
    >
    >
    > ## Quick example without off-target searching or annotation
    > ## First generate data with the sgRNA_Design Function
    > testseq <- "GGCAGAGCTTCGTATGTCGGCGATTCATCTCAAGTAGAAGATCCTGGTGCAGTAGG"
    > usergenome <- "placeholder"
    > gtfname <- "placeholder"
    > alldata <- sgRNA_design(testseq, usergenome, gtfname, calloffs = FALSE)
    Searching sequence for possible target sites
    Error in `stringr::str_replace_all()`:
    ! `string` must be a vector, not a <DNAString> object.
    Backtrace:
     ▆
     1. ├─crispRdesignR::sgRNA_design(testseq, usergenome, gtfname, calloffs = FALSE)
     2. │ └─stringr::str_replace_all(revsetPAM, "N", ".")
     3. │ └─stringr:::check_lengths(string, pattern, replacement)
     4. │ └─vctrs::vec_size_common(...)
     5. └─vctrs:::stop_scalar_type(...)
     6. └─vctrs:::stop_vctrs(...)
     7. └─rlang::abort(message, class = c(class, "vctrs_error"), ..., call = vctrs_error_call(call))
    Execution halted
Flavor: r-devel-linux-x86_64-fedora-clang

Version: 1.1.6
Check: examples
Result: ERROR
    Running examples in ‘crispRdesignR-Ex.R’ failed
    The error most likely occurred in:
    
    > ### Name: getofftargetdata
    > ### Title: Off Target Data Frame Creation
    > ### Aliases: getofftargetdata
    >
    > ### ** Examples
    >
    >
    > ## Quick example without off-target searching or annotation
    > ## First generate data with the sgRNA_Design Function
    > testseq <- "GGCAGAGCTTCGTATGTCGGCGATTCATCTCAAGTAGAAGATCCTGGTGCAGTAGG"
    > usergenome <- "placeholder"
    > gtfname <- "placeholder"
    > alldata <- sgRNA_design(testseq, usergenome, gtfname, calloffs = FALSE)
    Searching sequence for possible target sites
    Error in `stringr::str_replace_all()`:
    ! `string` must be a vector, not a <DNAString> object.
    Backtrace:
     ▆
     1. ├─crispRdesignR::sgRNA_design(testseq, usergenome, gtfname, calloffs = FALSE)
     2. │ └─stringr::str_replace_all(revsetPAM, "N", ".")
     3. │ └─stringr:::check_lengths(string, pattern, replacement)
     4. │ └─vctrs::vec_size_common(...)
     5. └─vctrs:::stop_scalar_type(`<fn>`(`<DNAStrng>`), "string", `<env>`)
     6. └─vctrs:::stop_vctrs(...)
     7. └─rlang::abort(message, class = c(class, "vctrs_error"), ..., call = vctrs_error_call(call))
    Execution halted
Flavor: r-devel-linux-x86_64-fedora-gcc

Version: 1.1.6
Check: package dependencies
Result: NOTE
    Package suggested but not available for checking: ‘BSgenome.Scerevisiae.UCSC.sacCer2’
Flavors: r-release-macos-arm64, r-release-macos-x86_64, r-oldrel-macos-arm64, r-oldrel-macos-x86_64