CRAN Package Check Results for Package poplite

Last updated on 2019-02-18 06:47:08 CET.

Flavor Version Tinstall Tcheck Ttotal Status Flags
r-devel-linux-x86_64-debian-clang 0.99.19 4.47 83.09 87.56 ERROR
r-devel-linux-x86_64-debian-gcc 0.99.19 3.90 63.41 67.31 ERROR
r-devel-linux-x86_64-fedora-clang 0.99.19 107.87 ERROR
r-devel-linux-x86_64-fedora-gcc 0.99.19 99.47 ERROR
r-devel-windows-ix86+x86_64 0.99.19 14.00 99.00 113.00 ERROR
r-patched-linux-x86_64 0.99.19 4.58 77.54 82.12 ERROR
r-patched-solaris-x86 0.99.19 141.50 ERROR
r-release-linux-x86_64 0.99.19 ERROR
r-release-windows-ix86+x86_64 0.99.19 8.00 138.00 146.00 OK
r-release-osx-x86_64 0.99.19 WARN
r-oldrel-windows-ix86+x86_64 0.99.19 13.00 101.00 114.00 ERROR
r-oldrel-osx-x86_64 0.99.19 WARN

Check Details

Version: 0.99.19
Check: for code/documentation mismatches
Result: WARN
    Codoc mismatches from documentation object 'External methods':
    filter
     Code: function(.data, ..., .preserve = FALSE)
     Docs: function(.data, ...)
     Argument names in code not in docs:
     .preserve
Flavors: r-devel-linux-x86_64-debian-clang, r-devel-linux-x86_64-debian-gcc, r-devel-linux-x86_64-fedora-clang, r-devel-linux-x86_64-fedora-gcc, r-devel-windows-ix86+x86_64, r-patched-linux-x86_64, r-patched-solaris-x86, r-release-linux-x86_64, r-oldrel-windows-ix86+x86_64

Version: 0.99.19
Check: tests
Result: ERROR
     Running ‘testthat.R’ [3s/4s]
    Running the tests in ‘tests/testthat.R’ failed.
    Complete output:
     > library(testthat)
     > library(Lahman)
     > library(DBI)
     > library(poplite)
     Loading required package: dplyr
    
     Attaching package: 'dplyr'
    
     The following object is masked from 'package:testthat':
    
     matches
    
     The following objects are masked from 'package:stats':
    
     filter, lag
    
     The following objects are masked from 'package:base':
    
     intersect, setdiff, setequal, union
    
    
     Attaching package: 'poplite'
    
     The following object is masked from 'package:dplyr':
    
     select
    
     The following object is masked from 'package:stats':
    
     filter
    
     >
     > test.db.1 <- function()
     + {
     + samples <- data.frame(sample_id=as.integer(sapply(1:100, function(x) rep(x,2))), wave=as.integer(sapply(1:100, function(x) 1:2)), did_collect=sample(c("Y", "N"), size=100, replace=T))
     +
     + dna <- samples[samples$did_collect == "Y",c("sample_id", "wave")]
     + dna$lab_id <- paste("dna", paste(dna$sample_id, dna$wave, sep="_"), sep="_")
     + dna$lab_id[sample.int(nrow(dna), size=10)] <- NA
     + dna$ng.ul <- abs(rnorm(n=nrow(dna), mean=146, sd=98))
     + dna$ng.ul[is.na(dna$lab_id)] <- NA
     +
     + clinical <- data.frame(sample_id=1:100, sex=sample(c("M", "F"), size=100, replace=T), age=sample(1:20, 100, replace=T), status=sample(c(0L,1L), size=100, replace=T), var_wave_1=rnorm(n=100), var_wave_2=rnorm(n=100))
     + clinical <- clinical[-sample.int(nrow(clinical), 12),]
     +
     + return(list(samples=samples, dna=dna, clinical=clinical))
     + }
     >
     > test.db.2 <- eval(structure(list(allele = structure(list(allele_id = 1:10, alleles = c(".",
     + "G", "A", ".", "A", "T", ".", "C", "A", "."), allele_num = c(-1L,
     + 0L, 1L, -1L, 0L, 1L, -1L, 0L, 1L, -1L), ref_id = c(1L, 1L, 1L,
     + 2L, 2L, 2L, 3L, 3L, 3L, 4L)), .Names = c("allele_id", "alleles",
     + "allele_num", "ref_id"), row.names = c(NA, -10L), class = "data.frame"),
     + genotype = structure(list(geno_id = c(1L, 2L, 3L, 4L, 5L,
     + 6L, 7L, 8L, 9L, 11L), geno_chr = c(1L, 1L, 1L, 1L, 1L, 1L,
     + 1L, 1L, 1L, 1L), allele_num = c(1L, 1L, 1L, 1L, 1L, 1L, 1L,
     + 1L, 1L, 1L), strain = c("NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
     + "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
     + "NODShiLtJ", "NODShiLtJ"), ref_id = c(1L, 2L, 3L, 4L, 5L,
     + 6L, 7L, 8L, 9L, 11L)), .Names = c("geno_id", "geno_chr",
     + "allele_num", "strain", "ref_id"), row.names = c(NA, -10L
     + ), class = "data.frame"), probe_align = structure(list(probe_align_id = 1:10,
     + probe_chr = c("1", "1", "1", "1", "1", "1", "1", "1",
     + "1", "1"), probe_start = c(3214633L, 3214895L, 3215576L,
     + 3216284L, 3216483L, 3216537L, 3216591L, 3421710L, 3421740L,
     + 3421808L), probe_end = c(3214657L, 3214919L, 3215600L,
     + 3216308L, 3216507L, 3216561L, 3216615L, 3421734L, 3421764L,
     + 3421832L), probe_ind = 23944:23953), .Names = c("probe_align_id",
     + "probe_chr", "probe_start", "probe_end", "probe_ind"), row.names = c(NA,
     + -10L), class = "data.frame"), probe_info = structure(list(
     + probe_ind = 1:10, fasta_name = c("chr1:3044331-3044355;+;GGGCTCAAATTCACCTGTGTTAACT",
     + "chr1:3044334-3044358;+;AGGGGGCTCAAATTCACCTGTGTTA", "chr1:3044335-3044359;+;GAGGGGGCTCAAATTCACCTGTGTT",
     + "chr1:3044336-3044360;+;GGAGGGGGCTCAAATTCACCTGTGT", "chr1:3044337-3044361;+;GGGAGGGGGCTCAAATTCACCTGTG",
     + "chr1:3044504-3044528;+;AAGGCTTGGGCTATGCGCTCTCCAG", "chr1:3044557-3044581;+;AAGGTCCTCGCTCCTCTTTCATATA",
     + "chr1:3044558-3044582;+;GAAGGTCCTCGCTCCTCTTTCATAT", "chr1:3044559-3044583;+;GGAAGGTCCTCGCTCCTCTTTCATA",
     + "chr1:3044560-3044584;+;AGGAAGGTCCTCGCTCCTCTTTCAT"),
     + probe_id = c(271822L, 866088L, 240008L, 34772L, 396933L,
     + 613322L, 984143L, 826914L, 1075207L, 160847L), align_status = c("MultiMapped",
     + "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
     + "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
     + "MultiMapped")), .Names = c("probe_ind", "fasta_name",
     + "probe_id", "align_status"), row.names = c(NA, -10L), class = "data.frame"),
     + probe_to_snp = structure(list(probe_snp_id = 1:10, ref_id = c(1L,
     + 2L, 3L, 4L, 5L, 6L, 7L, 8L, 9L, 9L), probe_align_id = c(137L,
     + 137L, 252L, 263L, 561L, 601L, 606L, 622L, 635L, 636L)), .Names = c("probe_snp_id",
     + "ref_id", "probe_align_id"), row.names = c(NA, -10L), class = "data.frame"),
     + reference = structure(list(ref_id = c(1L, 2L, 3L, 4L, 5L,
     + 6L, 7L, 8L, 9L, 11L), seqnames = c("1", "1", "1", "1", "1",
     + "1", "1", "1", "1", "1"), start = c(4785683L, 4785703L, 8595537L,
     + 8682000L, 10719780L, 12990759L, 13114284L, 13122474L, 13125617L,
     + 13150850L), end = c(4785683L, 4785703L, 8595537L, 8682000L,
     + 10719780L, 12990759L, 13114284L, 13122474L, 13125617L, 13150850L
     + ), filter = c("TRUE", "TRUE", "TRUE", "TRUE", "TRUE", "TRUE",
     + "TRUE", "TRUE", "TRUE", "TRUE"), vcf_annot_id = c(1L, 1L,
     + 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L)), .Names = c("ref_id", "seqnames",
     + "start", "end", "filter", "vcf_annot_id"), row.names = c(NA,
     + -10L), class = "data.frame"), vcf_annot = structure(list(
     + vcf_annot_id = 1L, vcf_name = "/Users/bottomly/Desktop/resources/vcfs/mgp.v3.snps.rsIDdbSNPv137.vcf.gz",
     + type = "SNV"), .Names = c("vcf_annot_id", "vcf_name",
     + "type"), row.names = c(NA, -1L), class = "data.frame")), .Names = c("allele",
     + "genotype", "probe_align", "probe_info", "probe_to_snp", "reference",
     + "vcf_annot")))
     >
     > test.schema.2 <- list(probe_info=list(db.cols=c("probe_ind", "fasta_name", "probe_id", "align_status"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "TEXT"),
     + db.constr="CONSTRAINT probe_idx UNIQUE (fasta_name)",
     + dta.func=function(x) x, should.ignore=FALSE, foreign.keys=NULL),
     + probe_align=list(db.cols=c("probe_align_id", "probe_chr", "probe_start", "probe_end", "probe_ind"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "INTEGER"),
     + db.constr="CONSTRAINT geno_idx UNIQUE (probe_chr, probe_start, probe_end, probe_ind)",
     + dta.func=function(x) x, should.ignore=FALSE, foreign.keys=list(probe_info=list(local.keys="probe_ind", ext.keys="fasta_name"))),
     + vcf_annot=list(db.cols=c("vcf_annot_id", "vcf_name", "type"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "TEXT"),
     + db.constr="CONSTRAINT probe_idx UNIQUE (vcf_name, type)",
     + dta.func=function(x) x,
     + should.ignore=TRUE, foreign.keys=NULL),
     + reference=list(db.cols=c("ref_id", "seqnames", "start", "end", "filter", "vcf_annot_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
     + db.constr="CONSTRAINT ref_idx UNIQUE (seqnames, start, end, vcf_annot_id)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")))),
     + allele=list(db.cols=c("allele_id", "alleles", "allele_num", "ref_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER"),
     + db.constr="CONSTRAINT alelle_idx UNIQUE (alleles, allele_num, ref_id)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
     + reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
     + genotype=list(db.cols=c("geno_id", "geno_chr", "allele_num","strain", "ref_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
     + db.constr="CONSTRAINT geno_idx UNIQUE (ref_id, strain, geno_chr, allele_num)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
     + reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
     + probe_to_snp=list(db.cols=c("probe_snp_id", "ref_id", "probe_align_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER"),
     + db.constr="CONSTRAINT p_s_idx UNIQUE (ref_id, probe_align_id)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
     + reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")),
     + probe_align=list(local.keys="probe_align_id", ext.keys=c("probe_chr", "probe_start", "probe_end")))))
     >
     >
     >
     >
     >
     > test_dir("testthat")
     ✔ | OK F W S | Context
    
     ⠋ | 1 | 0
     ⠙ | 2 | 0
     ⠹ | 3 | 0
     ⠸ | 4 | 0
     ⠼ | 5 | 0
     ⠴ | 6 | 0
     ⠦ | 7 | 0
     ⠧ | 8 | 0
     ⠇ | 9 | 0
     ⠏ | 10 | 0
     ⠋ | 11 | 0
     ⠙ | 12 | 0
     ⠹ | 13 | 0
     ⠸ | 14 | 0
     ⠼ | 15 | 0
     ⠴ | 16 | 0
     ⠦ | 17 | 0
     ⠧ | 18 | 0
     ⠇ | 19 | 0
     ⠏ | 20 | 0
     ⠋ | 21 | 0
     ⠙ | 22 | 0
     ⠹ | 23 | 0
     ⠸ | 24 | 0
     ⠼ | 25 | 0
     ⠴ | 26 | 0
     ⠦ | 27 | 0
     ⠧ | 28 | 0
     ⠇ | 29 | 0
     ⠏ | 30 | 0
     ⠋ | 31 | 0
     ⠙ | 32 | 0
     ⠹ | 33 | 0
     ⠸ | 34 | 0
     ⠼ | 35 | 0
     ⠴ | 36 | 0
     ⠦ | 37 | 0
     ⠧ | 38 | 0
     ⠇ | 39 | 0
     ⠏ | 40 | 0
     ⠋ | 41 | 0
     ⠙ | 42 | 0
     ⠹ | 43 | 0
     ⠸ | 44 | 0
     ⠼ | 45 | 0
     ⠴ | 46 | 0
     ⠦ | 47 | 0
     ⠧ | 48 | 0
     ⠇ | 49 | 0
     ⠏ | 50 | 0
     ⠋ | 51 | 0
     ⠙ | 52 | 0
     ⠹ | 53 | 0
     ⠸ | 54 | 0
     ⠼ | 55 | 0
     ⠴ | 56 | 0
     ⠦ | 57 | 0
     ⠧ | 58 | 0
     ⠇ | 59 | 0
     ⠏ | 60 | 0
     ⠋ | 61 | 0
     ⠙ | 62 | 0
     ⠹ | 63 | 0
     ⠸ | 64 | 0
     ⠼ | 65 | 0
     ⠴ | 66 | 0
     ⠦ | 67 | 0
     ⠧ | 68 | 0
     ⠇ | 69 | 0
     ⠏ | 70 | 0
     ⠋ | 71 | 0
     ⠙ | 72 | 0
     ⠹ | 73 | 0
     ⠸ | 74 | 0
     ⠼ | 75 | 0
     ⠴ | 76 | 0
     ⠦ | 77 | 0
     ⠧ | 78 | 0
     ⠇ | 79 | 0
     ⠏ | 80 | 0[1] "clinical"
     [1] "normal"
    
     ⠋ | 81 | 0
     ⠙ | 82 | 0[1] "merge"
    
     ⠹ | 83 | 0[1] "dna"
     [1] "normal"
    
     ⠸ | 84 | 0
     ⠼ | 85 | 0[1] "merge"
    
     ⠴ | 86 | 0[1] "samples"
     [1] "normal"
    
     ⠦ | 87 | 0
     ⠧ | 88 | 0[1] "merge"
    
     ⠇ | 89 | 0
     ⠏ | 90 | 0[1] "clinical"
     [1] "normal"
    
     ⠋ | 91 | 0
     ⠙ | 92 | 0[1] "merge"
    
     ⠹ | 93 | 0[1] "dna"
     [1] "normal"
    
     ⠸ | 94 | 0
     ⠼ | 95 | 0[1] "merge"
    
     ⠴ | 96 | 0[1] "samples"
     [1] "normal"
    
     ⠦ | 97 | 0
     ⠧ | 98 | 0[1] "merge"
    
     ⠇ | 99 | 0
     ⠏ | 100 | 0[1] "clinical"
    
     ⠋ | 101 | 0[1] "dna"
    
     ⠙ | 102 | 0
     ⠹ | 103 | 0
     ⠸ | 104 | 0
     ⠼ | 105 | 0[1] "samples"
    
     ⠴ | 106 | 0
     ⠦ | 107 | 0
     ⠧ | 108 | 0
     ⠇ | 109 | 0
     ⠏ | 110 | 0
     ⠋ | 111 | 0
     ⠙ | 112 | 0
     ⠹ | 113 | 0
     ⠸ | 114 | 0
     ⠼ | 115 | 0
     ⠴ | 116 | 0
     ⠦ | 117 | 0
     ⠧ | 118 | 0
     ⠇ | 119 | 0
     ⠏ | 120 | 0
     ⠋ | 121 | 0
     ⠙ | 122 | 0Error in x[[method]](...) : attempt to apply non-function
     Calls: test_dir ... <Anonymous> -> o_apply -> lapply -> FUN -> <Anonymous>
    
     ══ Results ═════════════════════════════════════════════════════════════════════
     Duration: 1.7 s
    
     OK: 122
     Failed: 4
     Warnings: 1
     Skipped: 0
     Execution halted
Flavor: r-devel-linux-x86_64-debian-clang

Version: 0.99.19
Check: tests
Result: ERROR
     Running ‘testthat.R’ [3s/4s]
    Running the tests in ‘tests/testthat.R’ failed.
    Complete output:
     > library(testthat)
     > library(Lahman)
     > library(DBI)
     > library(poplite)
     Loading required package: dplyr
    
     Attaching package: 'dplyr'
    
     The following object is masked from 'package:testthat':
    
     matches
    
     The following objects are masked from 'package:stats':
    
     filter, lag
    
     The following objects are masked from 'package:base':
    
     intersect, setdiff, setequal, union
    
    
     Attaching package: 'poplite'
    
     The following object is masked from 'package:dplyr':
    
     select
    
     The following object is masked from 'package:stats':
    
     filter
    
     >
     > test.db.1 <- function()
     + {
     + samples <- data.frame(sample_id=as.integer(sapply(1:100, function(x) rep(x,2))), wave=as.integer(sapply(1:100, function(x) 1:2)), did_collect=sample(c("Y", "N"), size=100, replace=T))
     +
     + dna <- samples[samples$did_collect == "Y",c("sample_id", "wave")]
     + dna$lab_id <- paste("dna", paste(dna$sample_id, dna$wave, sep="_"), sep="_")
     + dna$lab_id[sample.int(nrow(dna), size=10)] <- NA
     + dna$ng.ul <- abs(rnorm(n=nrow(dna), mean=146, sd=98))
     + dna$ng.ul[is.na(dna$lab_id)] <- NA
     +
     + clinical <- data.frame(sample_id=1:100, sex=sample(c("M", "F"), size=100, replace=T), age=sample(1:20, 100, replace=T), status=sample(c(0L,1L), size=100, replace=T), var_wave_1=rnorm(n=100), var_wave_2=rnorm(n=100))
     + clinical <- clinical[-sample.int(nrow(clinical), 12),]
     +
     + return(list(samples=samples, dna=dna, clinical=clinical))
     + }
     >
     > test.db.2 <- eval(structure(list(allele = structure(list(allele_id = 1:10, alleles = c(".",
     + "G", "A", ".", "A", "T", ".", "C", "A", "."), allele_num = c(-1L,
     + 0L, 1L, -1L, 0L, 1L, -1L, 0L, 1L, -1L), ref_id = c(1L, 1L, 1L,
     + 2L, 2L, 2L, 3L, 3L, 3L, 4L)), .Names = c("allele_id", "alleles",
     + "allele_num", "ref_id"), row.names = c(NA, -10L), class = "data.frame"),
     + genotype = structure(list(geno_id = c(1L, 2L, 3L, 4L, 5L,
     + 6L, 7L, 8L, 9L, 11L), geno_chr = c(1L, 1L, 1L, 1L, 1L, 1L,
     + 1L, 1L, 1L, 1L), allele_num = c(1L, 1L, 1L, 1L, 1L, 1L, 1L,
     + 1L, 1L, 1L), strain = c("NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
     + "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
     + "NODShiLtJ", "NODShiLtJ"), ref_id = c(1L, 2L, 3L, 4L, 5L,
     + 6L, 7L, 8L, 9L, 11L)), .Names = c("geno_id", "geno_chr",
     + "allele_num", "strain", "ref_id"), row.names = c(NA, -10L
     + ), class = "data.frame"), probe_align = structure(list(probe_align_id = 1:10,
     + probe_chr = c("1", "1", "1", "1", "1", "1", "1", "1",
     + "1", "1"), probe_start = c(3214633L, 3214895L, 3215576L,
     + 3216284L, 3216483L, 3216537L, 3216591L, 3421710L, 3421740L,
     + 3421808L), probe_end = c(3214657L, 3214919L, 3215600L,
     + 3216308L, 3216507L, 3216561L, 3216615L, 3421734L, 3421764L,
     + 3421832L), probe_ind = 23944:23953), .Names = c("probe_align_id",
     + "probe_chr", "probe_start", "probe_end", "probe_ind"), row.names = c(NA,
     + -10L), class = "data.frame"), probe_info = structure(list(
     + probe_ind = 1:10, fasta_name = c("chr1:3044331-3044355;+;GGGCTCAAATTCACCTGTGTTAACT",
     + "chr1:3044334-3044358;+;AGGGGGCTCAAATTCACCTGTGTTA", "chr1:3044335-3044359;+;GAGGGGGCTCAAATTCACCTGTGTT",
     + "chr1:3044336-3044360;+;GGAGGGGGCTCAAATTCACCTGTGT", "chr1:3044337-3044361;+;GGGAGGGGGCTCAAATTCACCTGTG",
     + "chr1:3044504-3044528;+;AAGGCTTGGGCTATGCGCTCTCCAG", "chr1:3044557-3044581;+;AAGGTCCTCGCTCCTCTTTCATATA",
     + "chr1:3044558-3044582;+;GAAGGTCCTCGCTCCTCTTTCATAT", "chr1:3044559-3044583;+;GGAAGGTCCTCGCTCCTCTTTCATA",
     + "chr1:3044560-3044584;+;AGGAAGGTCCTCGCTCCTCTTTCAT"),
     + probe_id = c(271822L, 866088L, 240008L, 34772L, 396933L,
     + 613322L, 984143L, 826914L, 1075207L, 160847L), align_status = c("MultiMapped",
     + "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
     + "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
     + "MultiMapped")), .Names = c("probe_ind", "fasta_name",
     + "probe_id", "align_status"), row.names = c(NA, -10L), class = "data.frame"),
     + probe_to_snp = structure(list(probe_snp_id = 1:10, ref_id = c(1L,
     + 2L, 3L, 4L, 5L, 6L, 7L, 8L, 9L, 9L), probe_align_id = c(137L,
     + 137L, 252L, 263L, 561L, 601L, 606L, 622L, 635L, 636L)), .Names = c("probe_snp_id",
     + "ref_id", "probe_align_id"), row.names = c(NA, -10L), class = "data.frame"),
     + reference = structure(list(ref_id = c(1L, 2L, 3L, 4L, 5L,
     + 6L, 7L, 8L, 9L, 11L), seqnames = c("1", "1", "1", "1", "1",
     + "1", "1", "1", "1", "1"), start = c(4785683L, 4785703L, 8595537L,
     + 8682000L, 10719780L, 12990759L, 13114284L, 13122474L, 13125617L,
     + 13150850L), end = c(4785683L, 4785703L, 8595537L, 8682000L,
     + 10719780L, 12990759L, 13114284L, 13122474L, 13125617L, 13150850L
     + ), filter = c("TRUE", "TRUE", "TRUE", "TRUE", "TRUE", "TRUE",
     + "TRUE", "TRUE", "TRUE", "TRUE"), vcf_annot_id = c(1L, 1L,
     + 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L)), .Names = c("ref_id", "seqnames",
     + "start", "end", "filter", "vcf_annot_id"), row.names = c(NA,
     + -10L), class = "data.frame"), vcf_annot = structure(list(
     + vcf_annot_id = 1L, vcf_name = "/Users/bottomly/Desktop/resources/vcfs/mgp.v3.snps.rsIDdbSNPv137.vcf.gz",
     + type = "SNV"), .Names = c("vcf_annot_id", "vcf_name",
     + "type"), row.names = c(NA, -1L), class = "data.frame")), .Names = c("allele",
     + "genotype", "probe_align", "probe_info", "probe_to_snp", "reference",
     + "vcf_annot")))
     >
     > test.schema.2 <- list(probe_info=list(db.cols=c("probe_ind", "fasta_name", "probe_id", "align_status"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "TEXT"),
     + db.constr="CONSTRAINT probe_idx UNIQUE (fasta_name)",
     + dta.func=function(x) x, should.ignore=FALSE, foreign.keys=NULL),
     + probe_align=list(db.cols=c("probe_align_id", "probe_chr", "probe_start", "probe_end", "probe_ind"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "INTEGER"),
     + db.constr="CONSTRAINT geno_idx UNIQUE (probe_chr, probe_start, probe_end, probe_ind)",
     + dta.func=function(x) x, should.ignore=FALSE, foreign.keys=list(probe_info=list(local.keys="probe_ind", ext.keys="fasta_name"))),
     + vcf_annot=list(db.cols=c("vcf_annot_id", "vcf_name", "type"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "TEXT"),
     + db.constr="CONSTRAINT probe_idx UNIQUE (vcf_name, type)",
     + dta.func=function(x) x,
     + should.ignore=TRUE, foreign.keys=NULL),
     + reference=list(db.cols=c("ref_id", "seqnames", "start", "end", "filter", "vcf_annot_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
     + db.constr="CONSTRAINT ref_idx UNIQUE (seqnames, start, end, vcf_annot_id)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")))),
     + allele=list(db.cols=c("allele_id", "alleles", "allele_num", "ref_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER"),
     + db.constr="CONSTRAINT alelle_idx UNIQUE (alleles, allele_num, ref_id)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
     + reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
     + genotype=list(db.cols=c("geno_id", "geno_chr", "allele_num","strain", "ref_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
     + db.constr="CONSTRAINT geno_idx UNIQUE (ref_id, strain, geno_chr, allele_num)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
     + reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
     + probe_to_snp=list(db.cols=c("probe_snp_id", "ref_id", "probe_align_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER"),
     + db.constr="CONSTRAINT p_s_idx UNIQUE (ref_id, probe_align_id)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
     + reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")),
     + probe_align=list(local.keys="probe_align_id", ext.keys=c("probe_chr", "probe_start", "probe_end")))))
     >
     >
     >
     >
     >
     > test_dir("testthat")
     ✔ | OK F W S | Context
    
     ⠋ | 1 | 0
     ⠙ | 2 | 0
     ⠹ | 3 | 0
     ⠸ | 4 | 0
     ⠼ | 5 | 0
     ⠴ | 6 | 0
     ⠦ | 7 | 0
     ⠧ | 8 | 0
     ⠇ | 9 | 0
     ⠏ | 10 | 0
     ⠋ | 11 | 0
     ⠙ | 12 | 0
     ⠹ | 13 | 0
     ⠸ | 14 | 0
     ⠼ | 15 | 0
     ⠴ | 16 | 0
     ⠦ | 17 | 0
     ⠧ | 18 | 0
     ⠇ | 19 | 0
     ⠏ | 20 | 0
     ⠋ | 21 | 0
     ⠙ | 22 | 0
     ⠹ | 23 | 0
     ⠸ | 24 | 0
     ⠼ | 25 | 0
     ⠴ | 26 | 0
     ⠦ | 27 | 0
     ⠧ | 28 | 0
     ⠇ | 29 | 0
     ⠏ | 30 | 0
     ⠋ | 31 | 0
     ⠙ | 32 | 0
     ⠹ | 33 | 0
     ⠸ | 34 | 0
     ⠼ | 35 | 0
     ⠴ | 36 | 0
     ⠦ | 37 | 0
     ⠧ | 38 | 0
     ⠇ | 39 | 0
     ⠏ | 40 | 0
     ⠋ | 41 | 0
     ⠙ | 42 | 0
     ⠹ | 43 | 0
     ⠸ | 44 | 0
     ⠼ | 45 | 0
     ⠴ | 46 | 0
     ⠦ | 47 | 0
     ⠧ | 48 | 0
     ⠇ | 49 | 0
     ⠏ | 50 | 0
     ⠋ | 51 | 0
     ⠙ | 52 | 0
     ⠹ | 53 | 0
     ⠸ | 54 | 0
     ⠼ | 55 | 0
     ⠴ | 56 | 0
     ⠦ | 57 | 0
     ⠧ | 58 | 0
     ⠇ | 59 | 0
     ⠏ | 60 | 0
     ⠋ | 61 | 0
     ⠙ | 62 | 0
     ⠹ | 63 | 0
     ⠸ | 64 | 0
     ⠼ | 65 | 0
     ⠴ | 66 | 0
     ⠦ | 67 | 0
     ⠧ | 68 | 0
     ⠇ | 69 | 0
     ⠏ | 70 | 0
     ⠋ | 71 | 0
     ⠙ | 72 | 0
     ⠹ | 73 | 0
     ⠸ | 74 | 0
     ⠼ | 75 | 0
     ⠴ | 76 | 0
     ⠦ | 77 | 0
     ⠧ | 78 | 0
     ⠇ | 79 | 0
     ⠏ | 80 | 0[1] "clinical"
     [1] "normal"
    
     ⠋ | 81 | 0
     ⠙ | 82 | 0[1] "merge"
    
     ⠹ | 83 | 0[1] "dna"
     [1] "normal"
    
     ⠸ | 84 | 0
     ⠼ | 85 | 0[1] "merge"
    
     ⠴ | 86 | 0[1] "samples"
     [1] "normal"
    
     ⠦ | 87 | 0
     ⠧ | 88 | 0[1] "merge"
    
     ⠇ | 89 | 0
     ⠏ | 90 | 0[1] "clinical"
     [1] "normal"
    
     ⠋ | 91 | 0
     ⠙ | 92 | 0[1] "merge"
    
     ⠹ | 93 | 0[1] "dna"
     [1] "normal"
    
     ⠸ | 94 | 0
     ⠼ | 95 | 0[1] "merge"
    
     ⠴ | 96 | 0[1] "samples"
     [1] "normal"
    
     ⠦ | 97 | 0
     ⠧ | 98 | 0[1] "merge"
    
     ⠇ | 99 | 0
     ⠏ | 100 | 0[1] "clinical"
    
     ⠋ | 101 | 0[1] "dna"
    
     ⠙ | 102 | 0
     ⠹ | 103 | 0
     ⠸ | 104 | 0
     ⠼ | 105 | 0[1] "samples"
    
     ⠴ | 106 | 0
     ⠦ | 107 | 0
     ⠧ | 108 | 0
     ⠇ | 109 | 0
     ⠏ | 110 | 0
     ⠋ | 111 | 0
     ⠙ | 112 | 0
     ⠹ | 113 | 0
     ⠸ | 114 | 0
     ⠼ | 115 | 0
     ⠴ | 116 | 0
     ⠦ | 117 | 0
     ⠧ | 118 | 0
     ⠇ | 119 | 0
     ⠏ | 120 | 0
     ⠋ | 121 | 0
     ⠙ | 122 | 0Error in x[[method]](...) : attempt to apply non-function
     Calls: test_dir ... <Anonymous> -> o_apply -> lapply -> FUN -> <Anonymous>
    
     ══ Results ═════════════════════════════════════════════════════════════════════
     Duration: 1.6 s
    
     OK: 122
     Failed: 4
     Warnings: 1
     Skipped: 0
     Execution halted
Flavor: r-devel-linux-x86_64-debian-gcc

Version: 0.99.19
Check: tests
Result: ERROR
     Running ‘testthat.R’
    Running the tests in ‘tests/testthat.R’ failed.
    Complete output:
     > library(testthat)
     > library(Lahman)
     > library(DBI)
     > library(poplite)
     Loading required package: dplyr
    
     Attaching package: 'dplyr'
    
     The following object is masked from 'package:testthat':
    
     matches
    
     The following objects are masked from 'package:stats':
    
     filter, lag
    
     The following objects are masked from 'package:base':
    
     intersect, setdiff, setequal, union
    
    
     Attaching package: 'poplite'
    
     The following object is masked from 'package:dplyr':
    
     select
    
     The following object is masked from 'package:stats':
    
     filter
    
     >
     > test.db.1 <- function()
     + {
     + samples <- data.frame(sample_id=as.integer(sapply(1:100, function(x) rep(x,2))), wave=as.integer(sapply(1:100, function(x) 1:2)), did_collect=sample(c("Y", "N"), size=100, replace=T))
     +
     + dna <- samples[samples$did_collect == "Y",c("sample_id", "wave")]
     + dna$lab_id <- paste("dna", paste(dna$sample_id, dna$wave, sep="_"), sep="_")
     + dna$lab_id[sample.int(nrow(dna), size=10)] <- NA
     + dna$ng.ul <- abs(rnorm(n=nrow(dna), mean=146, sd=98))
     + dna$ng.ul[is.na(dna$lab_id)] <- NA
     +
     + clinical <- data.frame(sample_id=1:100, sex=sample(c("M", "F"), size=100, replace=T), age=sample(1:20, 100, replace=T), status=sample(c(0L,1L), size=100, replace=T), var_wave_1=rnorm(n=100), var_wave_2=rnorm(n=100))
     + clinical <- clinical[-sample.int(nrow(clinical), 12),]
     +
     + return(list(samples=samples, dna=dna, clinical=clinical))
     + }
     >
     > test.db.2 <- eval(structure(list(allele = structure(list(allele_id = 1:10, alleles = c(".",
     + "G", "A", ".", "A", "T", ".", "C", "A", "."), allele_num = c(-1L,
     + 0L, 1L, -1L, 0L, 1L, -1L, 0L, 1L, -1L), ref_id = c(1L, 1L, 1L,
     + 2L, 2L, 2L, 3L, 3L, 3L, 4L)), .Names = c("allele_id", "alleles",
     + "allele_num", "ref_id"), row.names = c(NA, -10L), class = "data.frame"),
     + genotype = structure(list(geno_id = c(1L, 2L, 3L, 4L, 5L,
     + 6L, 7L, 8L, 9L, 11L), geno_chr = c(1L, 1L, 1L, 1L, 1L, 1L,
     + 1L, 1L, 1L, 1L), allele_num = c(1L, 1L, 1L, 1L, 1L, 1L, 1L,
     + 1L, 1L, 1L), strain = c("NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
     + "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
     + "NODShiLtJ", "NODShiLtJ"), ref_id = c(1L, 2L, 3L, 4L, 5L,
     + 6L, 7L, 8L, 9L, 11L)), .Names = c("geno_id", "geno_chr",
     + "allele_num", "strain", "ref_id"), row.names = c(NA, -10L
     + ), class = "data.frame"), probe_align = structure(list(probe_align_id = 1:10,
     + probe_chr = c("1", "1", "1", "1", "1", "1", "1", "1",
     + "1", "1"), probe_start = c(3214633L, 3214895L, 3215576L,
     + 3216284L, 3216483L, 3216537L, 3216591L, 3421710L, 3421740L,
     + 3421808L), probe_end = c(3214657L, 3214919L, 3215600L,
     + 3216308L, 3216507L, 3216561L, 3216615L, 3421734L, 3421764L,
     + 3421832L), probe_ind = 23944:23953), .Names = c("probe_align_id",
     + "probe_chr", "probe_start", "probe_end", "probe_ind"), row.names = c(NA,
     + -10L), class = "data.frame"), probe_info = structure(list(
     + probe_ind = 1:10, fasta_name = c("chr1:3044331-3044355;+;GGGCTCAAATTCACCTGTGTTAACT",
     + "chr1:3044334-3044358;+;AGGGGGCTCAAATTCACCTGTGTTA", "chr1:3044335-3044359;+;GAGGGGGCTCAAATTCACCTGTGTT",
     + "chr1:3044336-3044360;+;GGAGGGGGCTCAAATTCACCTGTGT", "chr1:3044337-3044361;+;GGGAGGGGGCTCAAATTCACCTGTG",
     + "chr1:3044504-3044528;+;AAGGCTTGGGCTATGCGCTCTCCAG", "chr1:3044557-3044581;+;AAGGTCCTCGCTCCTCTTTCATATA",
     + "chr1:3044558-3044582;+;GAAGGTCCTCGCTCCTCTTTCATAT", "chr1:3044559-3044583;+;GGAAGGTCCTCGCTCCTCTTTCATA",
     + "chr1:3044560-3044584;+;AGGAAGGTCCTCGCTCCTCTTTCAT"),
     + probe_id = c(271822L, 866088L, 240008L, 34772L, 396933L,
     + 613322L, 984143L, 826914L, 1075207L, 160847L), align_status = c("MultiMapped",
     + "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
     + "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
     + "MultiMapped")), .Names = c("probe_ind", "fasta_name",
     + "probe_id", "align_status"), row.names = c(NA, -10L), class = "data.frame"),
     + probe_to_snp = structure(list(probe_snp_id = 1:10, ref_id = c(1L,
     + 2L, 3L, 4L, 5L, 6L, 7L, 8L, 9L, 9L), probe_align_id = c(137L,
     + 137L, 252L, 263L, 561L, 601L, 606L, 622L, 635L, 636L)), .Names = c("probe_snp_id",
     + "ref_id", "probe_align_id"), row.names = c(NA, -10L), class = "data.frame"),
     + reference = structure(list(ref_id = c(1L, 2L, 3L, 4L, 5L,
     + 6L, 7L, 8L, 9L, 11L), seqnames = c("1", "1", "1", "1", "1",
     + "1", "1", "1", "1", "1"), start = c(4785683L, 4785703L, 8595537L,
     + 8682000L, 10719780L, 12990759L, 13114284L, 13122474L, 13125617L,
     + 13150850L), end = c(4785683L, 4785703L, 8595537L, 8682000L,
     + 10719780L, 12990759L, 13114284L, 13122474L, 13125617L, 13150850L
     + ), filter = c("TRUE", "TRUE", "TRUE", "TRUE", "TRUE", "TRUE",
     + "TRUE", "TRUE", "TRUE", "TRUE"), vcf_annot_id = c(1L, 1L,
     + 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L)), .Names = c("ref_id", "seqnames",
     + "start", "end", "filter", "vcf_annot_id"), row.names = c(NA,
     + -10L), class = "data.frame"), vcf_annot = structure(list(
     + vcf_annot_id = 1L, vcf_name = "/Users/bottomly/Desktop/resources/vcfs/mgp.v3.snps.rsIDdbSNPv137.vcf.gz",
     + type = "SNV"), .Names = c("vcf_annot_id", "vcf_name",
     + "type"), row.names = c(NA, -1L), class = "data.frame")), .Names = c("allele",
     + "genotype", "probe_align", "probe_info", "probe_to_snp", "reference",
     + "vcf_annot")))
     >
     > test.schema.2 <- list(probe_info=list(db.cols=c("probe_ind", "fasta_name", "probe_id", "align_status"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "TEXT"),
     + db.constr="CONSTRAINT probe_idx UNIQUE (fasta_name)",
     + dta.func=function(x) x, should.ignore=FALSE, foreign.keys=NULL),
     + probe_align=list(db.cols=c("probe_align_id", "probe_chr", "probe_start", "probe_end", "probe_ind"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "INTEGER"),
     + db.constr="CONSTRAINT geno_idx UNIQUE (probe_chr, probe_start, probe_end, probe_ind)",
     + dta.func=function(x) x, should.ignore=FALSE, foreign.keys=list(probe_info=list(local.keys="probe_ind", ext.keys="fasta_name"))),
     + vcf_annot=list(db.cols=c("vcf_annot_id", "vcf_name", "type"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "TEXT"),
     + db.constr="CONSTRAINT probe_idx UNIQUE (vcf_name, type)",
     + dta.func=function(x) x,
     + should.ignore=TRUE, foreign.keys=NULL),
     + reference=list(db.cols=c("ref_id", "seqnames", "start", "end", "filter", "vcf_annot_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
     + db.constr="CONSTRAINT ref_idx UNIQUE (seqnames, start, end, vcf_annot_id)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")))),
     + allele=list(db.cols=c("allele_id", "alleles", "allele_num", "ref_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER"),
     + db.constr="CONSTRAINT alelle_idx UNIQUE (alleles, allele_num, ref_id)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
     + reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
     + genotype=list(db.cols=c("geno_id", "geno_chr", "allele_num","strain", "ref_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
     + db.constr="CONSTRAINT geno_idx UNIQUE (ref_id, strain, geno_chr, allele_num)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
     + reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
     + probe_to_snp=list(db.cols=c("probe_snp_id", "ref_id", "probe_align_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER"),
     + db.constr="CONSTRAINT p_s_idx UNIQUE (ref_id, probe_align_id)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
     + reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")),
     + probe_align=list(local.keys="probe_align_id", ext.keys=c("probe_chr", "probe_start", "probe_end")))))
     >
     >
     >
     >
     >
     > test_dir("testthat")
     ✔ | OK F W S | Context
    
     ⠋ | 1 | 0
     ⠙ | 2 | 0
     ⠹ | 3 | 0
     ⠸ | 4 | 0
     ⠼ | 5 | 0
     ⠴ | 6 | 0
     ⠦ | 7 | 0
     ⠧ | 8 | 0
     ⠇ | 9 | 0
     ⠏ | 10 | 0
     ⠋ | 11 | 0
     ⠙ | 12 | 0
     ⠹ | 13 | 0
     ⠸ | 14 | 0
     ⠼ | 15 | 0
     ⠴ | 16 | 0
     ⠦ | 17 | 0
     ⠧ | 18 | 0
     ⠇ | 19 | 0
     ⠏ | 20 | 0
     ⠋ | 21 | 0
     ⠙ | 22 | 0
     ⠹ | 23 | 0
     ⠸ | 24 | 0
     ⠼ | 25 | 0
     ⠴ | 26 | 0
     ⠦ | 27 | 0
     ⠧ | 28 | 0
     ⠇ | 29 | 0
     ⠏ | 30 | 0
     ⠋ | 31 | 0
     ⠙ | 32 | 0
     ⠹ | 33 | 0
     ⠸ | 34 | 0
     ⠼ | 35 | 0
     ⠴ | 36 | 0
     ⠦ | 37 | 0
     ⠧ | 38 | 0
     ⠇ | 39 | 0
     ⠏ | 40 | 0
     ⠋ | 41 | 0
     ⠙ | 42 | 0
     ⠹ | 43 | 0
     ⠸ | 44 | 0
     ⠼ | 45 | 0
     ⠴ | 46 | 0
     ⠦ | 47 | 0
     ⠧ | 48 | 0
     ⠇ | 49 | 0
     ⠏ | 50 | 0
     ⠋ | 51 | 0
     ⠙ | 52 | 0
     ⠹ | 53 | 0
     ⠸ | 54 | 0
     ⠼ | 55 | 0
     ⠴ | 56 | 0
     ⠦ | 57 | 0
     ⠧ | 58 | 0
     ⠇ | 59 | 0
     ⠏ | 60 | 0
     ⠋ | 61 | 0
     ⠙ | 62 | 0
     ⠹ | 63 | 0
     ⠸ | 64 | 0
     ⠼ | 65 | 0
     ⠴ | 66 | 0
     ⠦ | 67 | 0
     ⠧ | 68 | 0
     ⠇ | 69 | 0
     ⠏ | 70 | 0
     ⠋ | 71 | 0
     ⠙ | 72 | 0
     ⠹ | 73 | 0
     ⠸ | 74 | 0
     ⠼ | 75 | 0
     ⠴ | 76 | 0
     ⠦ | 77 | 0
     ⠧ | 78 | 0
     ⠇ | 79 | 0
     ⠏ | 80 | 0[1] "clinical"
     [1] "normal"
    
     ⠋ | 81 | 0
     ⠙ | 82 | 0[1] "merge"
    
     ⠹ | 83 | 0[1] "dna"
     [1] "normal"
    
     ⠸ | 84 | 0
     ⠼ | 85 | 0[1] "merge"
    
     ⠴ | 86 | 0[1] "samples"
     [1] "normal"
    
     ⠦ | 87 | 0
     ⠧ | 88 | 0[1] "merge"
    
     ⠇ | 89 | 0
     ⠏ | 90 | 0[1] "clinical"
     [1] "normal"
    
     ⠋ | 91 | 0
     ⠙ | 92 | 0[1] "merge"
    
     ⠹ | 93 | 0[1] "dna"
     [1] "normal"
    
     ⠸ | 94 | 0
     ⠼ | 95 | 0[1] "merge"
    
     ⠴ | 96 | 0[1] "samples"
     [1] "normal"
    
     ⠦ | 97 | 0
     ⠧ | 98 | 0[1] "merge"
    
     ⠇ | 99 | 0
     ⠏ | 100 | 0[1] "clinical"
    
     ⠋ | 101 | 0[1] "dna"
    
     ⠙ | 102 | 0
     ⠹ | 103 | 0
     ⠸ | 104 | 0
     ⠼ | 105 | 0[1] "samples"
    
     ⠴ | 106 | 0
     ⠦ | 107 | 0
     ⠧ | 108 | 0
     ⠇ | 109 | 0
     ⠏ | 110 | 0
     ⠋ | 111 | 0
     ⠙ | 112 | 0
     ⠹ | 113 | 0
     ⠸ | 114 | 0
     ⠼ | 115 | 0
     ⠴ | 116 | 0
     ⠦ | 117 | 0
     ⠧ | 118 | 0
     ⠇ | 119 | 0
     ⠏ | 120 | 0
     ⠋ | 121 | 0
     ⠙ | 122 | 0Error in x[[method]](...) : attempt to apply non-function
     Calls: test_dir ... <Anonymous> -> o_apply -> lapply -> FUN -> <Anonymous>
    
     ══ Results ═════════════════════════════════════════════════════════════════════
     Duration: 2.3 s
    
     OK: 122
     Failed: 4
     Warnings: 1
     Skipped: 0
     Execution halted
Flavor: r-devel-linux-x86_64-fedora-clang

Version: 0.99.19
Check: tests
Result: ERROR
     Running ‘testthat.R’
    Running the tests in ‘tests/testthat.R’ failed.
    Complete output:
     > library(testthat)
     > library(Lahman)
     > library(DBI)
     > library(poplite)
     Loading required package: dplyr
    
     Attaching package: 'dplyr'
    
     The following object is masked from 'package:testthat':
    
     matches
    
     The following objects are masked from 'package:stats':
    
     filter, lag
    
     The following objects are masked from 'package:base':
    
     intersect, setdiff, setequal, union
    
    
     Attaching package: 'poplite'
    
     The following object is masked from 'package:dplyr':
    
     select
    
     The following object is masked from 'package:stats':
    
     filter
    
     >
     > test.db.1 <- function()
     + {
     + samples <- data.frame(sample_id=as.integer(sapply(1:100, function(x) rep(x,2))), wave=as.integer(sapply(1:100, function(x) 1:2)), did_collect=sample(c("Y", "N"), size=100, replace=T))
     +
     + dna <- samples[samples$did_collect == "Y",c("sample_id", "wave")]
     + dna$lab_id <- paste("dna", paste(dna$sample_id, dna$wave, sep="_"), sep="_")
     + dna$lab_id[sample.int(nrow(dna), size=10)] <- NA
     + dna$ng.ul <- abs(rnorm(n=nrow(dna), mean=146, sd=98))
     + dna$ng.ul[is.na(dna$lab_id)] <- NA
     +
     + clinical <- data.frame(sample_id=1:100, sex=sample(c("M", "F"), size=100, replace=T), age=sample(1:20, 100, replace=T), status=sample(c(0L,1L), size=100, replace=T), var_wave_1=rnorm(n=100), var_wave_2=rnorm(n=100))
     + clinical <- clinical[-sample.int(nrow(clinical), 12),]
     +
     + return(list(samples=samples, dna=dna, clinical=clinical))
     + }
     >
     > test.db.2 <- eval(structure(list(allele = structure(list(allele_id = 1:10, alleles = c(".",
     + "G", "A", ".", "A", "T", ".", "C", "A", "."), allele_num = c(-1L,
     + 0L, 1L, -1L, 0L, 1L, -1L, 0L, 1L, -1L), ref_id = c(1L, 1L, 1L,
     + 2L, 2L, 2L, 3L, 3L, 3L, 4L)), .Names = c("allele_id", "alleles",
     + "allele_num", "ref_id"), row.names = c(NA, -10L), class = "data.frame"),
     + genotype = structure(list(geno_id = c(1L, 2L, 3L, 4L, 5L,
     + 6L, 7L, 8L, 9L, 11L), geno_chr = c(1L, 1L, 1L, 1L, 1L, 1L,
     + 1L, 1L, 1L, 1L), allele_num = c(1L, 1L, 1L, 1L, 1L, 1L, 1L,
     + 1L, 1L, 1L), strain = c("NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
     + "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
     + "NODShiLtJ", "NODShiLtJ"), ref_id = c(1L, 2L, 3L, 4L, 5L,
     + 6L, 7L, 8L, 9L, 11L)), .Names = c("geno_id", "geno_chr",
     + "allele_num", "strain", "ref_id"), row.names = c(NA, -10L
     + ), class = "data.frame"), probe_align = structure(list(probe_align_id = 1:10,
     + probe_chr = c("1", "1", "1", "1", "1", "1", "1", "1",
     + "1", "1"), probe_start = c(3214633L, 3214895L, 3215576L,
     + 3216284L, 3216483L, 3216537L, 3216591L, 3421710L, 3421740L,
     + 3421808L), probe_end = c(3214657L, 3214919L, 3215600L,
     + 3216308L, 3216507L, 3216561L, 3216615L, 3421734L, 3421764L,
     + 3421832L), probe_ind = 23944:23953), .Names = c("probe_align_id",
     + "probe_chr", "probe_start", "probe_end", "probe_ind"), row.names = c(NA,
     + -10L), class = "data.frame"), probe_info = structure(list(
     + probe_ind = 1:10, fasta_name = c("chr1:3044331-3044355;+;GGGCTCAAATTCACCTGTGTTAACT",
     + "chr1:3044334-3044358;+;AGGGGGCTCAAATTCACCTGTGTTA", "chr1:3044335-3044359;+;GAGGGGGCTCAAATTCACCTGTGTT",
     + "chr1:3044336-3044360;+;GGAGGGGGCTCAAATTCACCTGTGT", "chr1:3044337-3044361;+;GGGAGGGGGCTCAAATTCACCTGTG",
     + "chr1:3044504-3044528;+;AAGGCTTGGGCTATGCGCTCTCCAG", "chr1:3044557-3044581;+;AAGGTCCTCGCTCCTCTTTCATATA",
     + "chr1:3044558-3044582;+;GAAGGTCCTCGCTCCTCTTTCATAT", "chr1:3044559-3044583;+;GGAAGGTCCTCGCTCCTCTTTCATA",
     + "chr1:3044560-3044584;+;AGGAAGGTCCTCGCTCCTCTTTCAT"),
     + probe_id = c(271822L, 866088L, 240008L, 34772L, 396933L,
     + 613322L, 984143L, 826914L, 1075207L, 160847L), align_status = c("MultiMapped",
     + "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
     + "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
     + "MultiMapped")), .Names = c("probe_ind", "fasta_name",
     + "probe_id", "align_status"), row.names = c(NA, -10L), class = "data.frame"),
     + probe_to_snp = structure(list(probe_snp_id = 1:10, ref_id = c(1L,
     + 2L, 3L, 4L, 5L, 6L, 7L, 8L, 9L, 9L), probe_align_id = c(137L,
     + 137L, 252L, 263L, 561L, 601L, 606L, 622L, 635L, 636L)), .Names = c("probe_snp_id",
     + "ref_id", "probe_align_id"), row.names = c(NA, -10L), class = "data.frame"),
     + reference = structure(list(ref_id = c(1L, 2L, 3L, 4L, 5L,
     + 6L, 7L, 8L, 9L, 11L), seqnames = c("1", "1", "1", "1", "1",
     + "1", "1", "1", "1", "1"), start = c(4785683L, 4785703L, 8595537L,
     + 8682000L, 10719780L, 12990759L, 13114284L, 13122474L, 13125617L,
     + 13150850L), end = c(4785683L, 4785703L, 8595537L, 8682000L,
     + 10719780L, 12990759L, 13114284L, 13122474L, 13125617L, 13150850L
     + ), filter = c("TRUE", "TRUE", "TRUE", "TRUE", "TRUE", "TRUE",
     + "TRUE", "TRUE", "TRUE", "TRUE"), vcf_annot_id = c(1L, 1L,
     + 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L)), .Names = c("ref_id", "seqnames",
     + "start", "end", "filter", "vcf_annot_id"), row.names = c(NA,
     + -10L), class = "data.frame"), vcf_annot = structure(list(
     + vcf_annot_id = 1L, vcf_name = "/Users/bottomly/Desktop/resources/vcfs/mgp.v3.snps.rsIDdbSNPv137.vcf.gz",
     + type = "SNV"), .Names = c("vcf_annot_id", "vcf_name",
     + "type"), row.names = c(NA, -1L), class = "data.frame")), .Names = c("allele",
     + "genotype", "probe_align", "probe_info", "probe_to_snp", "reference",
     + "vcf_annot")))
     >
     > test.schema.2 <- list(probe_info=list(db.cols=c("probe_ind", "fasta_name", "probe_id", "align_status"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "TEXT"),
     + db.constr="CONSTRAINT probe_idx UNIQUE (fasta_name)",
     + dta.func=function(x) x, should.ignore=FALSE, foreign.keys=NULL),
     + probe_align=list(db.cols=c("probe_align_id", "probe_chr", "probe_start", "probe_end", "probe_ind"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "INTEGER"),
     + db.constr="CONSTRAINT geno_idx UNIQUE (probe_chr, probe_start, probe_end, probe_ind)",
     + dta.func=function(x) x, should.ignore=FALSE, foreign.keys=list(probe_info=list(local.keys="probe_ind", ext.keys="fasta_name"))),
     + vcf_annot=list(db.cols=c("vcf_annot_id", "vcf_name", "type"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "TEXT"),
     + db.constr="CONSTRAINT probe_idx UNIQUE (vcf_name, type)",
     + dta.func=function(x) x,
     + should.ignore=TRUE, foreign.keys=NULL),
     + reference=list(db.cols=c("ref_id", "seqnames", "start", "end", "filter", "vcf_annot_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
     + db.constr="CONSTRAINT ref_idx UNIQUE (seqnames, start, end, vcf_annot_id)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")))),
     + allele=list(db.cols=c("allele_id", "alleles", "allele_num", "ref_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER"),
     + db.constr="CONSTRAINT alelle_idx UNIQUE (alleles, allele_num, ref_id)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
     + reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
     + genotype=list(db.cols=c("geno_id", "geno_chr", "allele_num","strain", "ref_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
     + db.constr="CONSTRAINT geno_idx UNIQUE (ref_id, strain, geno_chr, allele_num)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
     + reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
     + probe_to_snp=list(db.cols=c("probe_snp_id", "ref_id", "probe_align_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER"),
     + db.constr="CONSTRAINT p_s_idx UNIQUE (ref_id, probe_align_id)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
     + reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")),
     + probe_align=list(local.keys="probe_align_id", ext.keys=c("probe_chr", "probe_start", "probe_end")))))
     >
     >
     >
     >
     >
     > test_dir("testthat")
     ✔ | OK F W S | Context
    
     ⠋ | 1 | 0
     ⠙ | 2 | 0
     ⠹ | 3 | 0
     ⠸ | 4 | 0
     ⠼ | 5 | 0
     ⠴ | 6 | 0
     ⠦ | 7 | 0
     ⠧ | 8 | 0
     ⠇ | 9 | 0
     ⠏ | 10 | 0
     ⠋ | 11 | 0
     ⠙ | 12 | 0
     ⠹ | 13 | 0
     ⠸ | 14 | 0
     ⠼ | 15 | 0
     ⠴ | 16 | 0
     ⠦ | 17 | 0
     ⠧ | 18 | 0
     ⠇ | 19 | 0
     ⠏ | 20 | 0
     ⠋ | 21 | 0
     ⠙ | 22 | 0
     ⠹ | 23 | 0
     ⠸ | 24 | 0
     ⠼ | 25 | 0
     ⠴ | 26 | 0
     ⠦ | 27 | 0
     ⠧ | 28 | 0
     ⠇ | 29 | 0
     ⠏ | 30 | 0
     ⠋ | 31 | 0
     ⠙ | 32 | 0
     ⠹ | 33 | 0
     ⠸ | 34 | 0
     ⠼ | 35 | 0
     ⠴ | 36 | 0
     ⠦ | 37 | 0
     ⠧ | 38 | 0
     ⠇ | 39 | 0
     ⠏ | 40 | 0
     ⠋ | 41 | 0
     ⠙ | 42 | 0
     ⠹ | 43 | 0
     ⠸ | 44 | 0
     ⠼ | 45 | 0
     ⠴ | 46 | 0
     ⠦ | 47 | 0
     ⠧ | 48 | 0
     ⠇ | 49 | 0
     ⠏ | 50 | 0
     ⠋ | 51 | 0
     ⠙ | 52 | 0
     ⠹ | 53 | 0
     ⠸ | 54 | 0
     ⠼ | 55 | 0
     ⠴ | 56 | 0
     ⠦ | 57 | 0
     ⠧ | 58 | 0
     ⠇ | 59 | 0
     ⠏ | 60 | 0
     ⠋ | 61 | 0
     ⠙ | 62 | 0
     ⠹ | 63 | 0
     ⠸ | 64 | 0
     ⠼ | 65 | 0
     ⠴ | 66 | 0
     ⠦ | 67 | 0
     ⠧ | 68 | 0
     ⠇ | 69 | 0
     ⠏ | 70 | 0
     ⠋ | 71 | 0
     ⠙ | 72 | 0
     ⠹ | 73 | 0
     ⠸ | 74 | 0
     ⠼ | 75 | 0
     ⠴ | 76 | 0
     ⠦ | 77 | 0
     ⠧ | 78 | 0
     ⠇ | 79 | 0
     ⠏ | 80 | 0[1] "clinical"
     [1] "normal"
    
     ⠋ | 81 | 0
     ⠙ | 82 | 0[1] "merge"
    
     ⠹ | 83 | 0[1] "dna"
     [1] "normal"
    
     ⠸ | 84 | 0
     ⠼ | 85 | 0[1] "merge"
    
     ⠴ | 86 | 0[1] "samples"
     [1] "normal"
    
     ⠦ | 87 | 0
     ⠧ | 88 | 0[1] "merge"
    
     ⠇ | 89 | 0
     ⠏ | 90 | 0[1] "clinical"
     [1] "normal"
    
     ⠋ | 91 | 0
     ⠙ | 92 | 0[1] "merge"
    
     ⠹ | 93 | 0[1] "dna"
     [1] "normal"
    
     ⠸ | 94 | 0
     ⠼ | 95 | 0[1] "merge"
    
     ⠴ | 96 | 0[1] "samples"
     [1] "normal"
    
     ⠦ | 97 | 0
     ⠧ | 98 | 0[1] "merge"
    
     ⠇ | 99 | 0
     ⠏ | 100 | 0[1] "clinical"
    
     ⠋ | 101 | 0[1] "dna"
    
     ⠙ | 102 | 0
     ⠹ | 103 | 0
     ⠸ | 104 | 0
     ⠼ | 105 | 0[1] "samples"
    
     ⠴ | 106 | 0
     ⠦ | 107 | 0
     ⠧ | 108 | 0
     ⠇ | 109 | 0
     ⠏ | 110 | 0
     ⠋ | 111 | 0
     ⠙ | 112 | 0
     ⠹ | 113 | 0
     ⠸ | 114 | 0
     ⠼ | 115 | 0
     ⠴ | 116 | 0
     ⠦ | 117 | 0
     ⠧ | 118 | 0
     ⠇ | 119 | 0
     ⠏ | 120 | 0
     ⠋ | 121 | 0
     ⠙ | 122 | 0Error in x[[method]](...) : attempt to apply non-function
     Calls: test_dir ... <Anonymous> -> o_apply -> lapply -> FUN -> <Anonymous>
    
     ══ Results ═════════════════════════════════════════════════════════════════════
     Duration: 2.0 s
    
     OK: 122
     Failed: 4
     Warnings: 1
     Skipped: 0
     Execution halted
Flavor: r-devel-linux-x86_64-fedora-gcc

Version: 0.99.19
Check: tests
Result: ERROR
     Running 'testthat.R' [4s]
    Running the tests in 'tests/testthat.R' failed.
    Complete output:
     > library(testthat)
     > library(Lahman)
     > library(DBI)
     > library(poplite)
     Loading required package: dplyr
    
     Attaching package: 'dplyr'
    
     The following object is masked from 'package:testthat':
    
     matches
    
     The following objects are masked from 'package:stats':
    
     filter, lag
    
     The following objects are masked from 'package:base':
    
     intersect, setdiff, setequal, union
    
    
     Attaching package: 'poplite'
    
     The following object is masked from 'package:dplyr':
    
     select
    
     The following object is masked from 'package:stats':
    
     filter
    
     >
     > test.db.1 <- function()
     + {
     + samples <- data.frame(sample_id=as.integer(sapply(1:100, function(x) rep(x,2))), wave=as.integer(sapply(1:100, function(x) 1:2)), did_collect=sample(c("Y", "N"), size=100, replace=T))
     +
     + dna <- samples[samples$did_collect == "Y",c("sample_id", "wave")]
     + dna$lab_id <- paste("dna", paste(dna$sample_id, dna$wave, sep="_"), sep="_")
     + dna$lab_id[sample.int(nrow(dna), size=10)] <- NA
     + dna$ng.ul <- abs(rnorm(n=nrow(dna), mean=146, sd=98))
     + dna$ng.ul[is.na(dna$lab_id)] <- NA
     +
     + clinical <- data.frame(sample_id=1:100, sex=sample(c("M", "F"), size=100, replace=T), age=sample(1:20, 100, replace=T), status=sample(c(0L,1L), size=100, replace=T), var_wave_1=rnorm(n=100), var_wave_2=rnorm(n=100))
     + clinical <- clinical[-sample.int(nrow(clinical), 12),]
     +
     + return(list(samples=samples, dna=dna, clinical=clinical))
     + }
     >
     > test.db.2 <- eval(structure(list(allele = structure(list(allele_id = 1:10, alleles = c(".",
     + "G", "A", ".", "A", "T", ".", "C", "A", "."), allele_num = c(-1L,
     + 0L, 1L, -1L, 0L, 1L, -1L, 0L, 1L, -1L), ref_id = c(1L, 1L, 1L,
     + 2L, 2L, 2L, 3L, 3L, 3L, 4L)), .Names = c("allele_id", "alleles",
     + "allele_num", "ref_id"), row.names = c(NA, -10L), class = "data.frame"),
     + genotype = structure(list(geno_id = c(1L, 2L, 3L, 4L, 5L,
     + 6L, 7L, 8L, 9L, 11L), geno_chr = c(1L, 1L, 1L, 1L, 1L, 1L,
     + 1L, 1L, 1L, 1L), allele_num = c(1L, 1L, 1L, 1L, 1L, 1L, 1L,
     + 1L, 1L, 1L), strain = c("NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
     + "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
     + "NODShiLtJ", "NODShiLtJ"), ref_id = c(1L, 2L, 3L, 4L, 5L,
     + 6L, 7L, 8L, 9L, 11L)), .Names = c("geno_id", "geno_chr",
     + "allele_num", "strain", "ref_id"), row.names = c(NA, -10L
     + ), class = "data.frame"), probe_align = structure(list(probe_align_id = 1:10,
     + probe_chr = c("1", "1", "1", "1", "1", "1", "1", "1",
     + "1", "1"), probe_start = c(3214633L, 3214895L, 3215576L,
     + 3216284L, 3216483L, 3216537L, 3216591L, 3421710L, 3421740L,
     + 3421808L), probe_end = c(3214657L, 3214919L, 3215600L,
     + 3216308L, 3216507L, 3216561L, 3216615L, 3421734L, 3421764L,
     + 3421832L), probe_ind = 23944:23953), .Names = c("probe_align_id",
     + "probe_chr", "probe_start", "probe_end", "probe_ind"), row.names = c(NA,
     + -10L), class = "data.frame"), probe_info = structure(list(
     + probe_ind = 1:10, fasta_name = c("chr1:3044331-3044355;+;GGGCTCAAATTCACCTGTGTTAACT",
     + "chr1:3044334-3044358;+;AGGGGGCTCAAATTCACCTGTGTTA", "chr1:3044335-3044359;+;GAGGGGGCTCAAATTCACCTGTGTT",
     + "chr1:3044336-3044360;+;GGAGGGGGCTCAAATTCACCTGTGT", "chr1:3044337-3044361;+;GGGAGGGGGCTCAAATTCACCTGTG",
     + "chr1:3044504-3044528;+;AAGGCTTGGGCTATGCGCTCTCCAG", "chr1:3044557-3044581;+;AAGGTCCTCGCTCCTCTTTCATATA",
     + "chr1:3044558-3044582;+;GAAGGTCCTCGCTCCTCTTTCATAT", "chr1:3044559-3044583;+;GGAAGGTCCTCGCTCCTCTTTCATA",
     + "chr1:3044560-3044584;+;AGGAAGGTCCTCGCTCCTCTTTCAT"),
     + probe_id = c(271822L, 866088L, 240008L, 34772L, 396933L,
     + 613322L, 984143L, 826914L, 1075207L, 160847L), align_status = c("MultiMapped",
     + "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
     + "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
     + "MultiMapped")), .Names = c("probe_ind", "fasta_name",
     + "probe_id", "align_status"), row.names = c(NA, -10L), class = "data.frame"),
     + probe_to_snp = structure(list(probe_snp_id = 1:10, ref_id = c(1L,
     + 2L, 3L, 4L, 5L, 6L, 7L, 8L, 9L, 9L), probe_align_id = c(137L,
     + 137L, 252L, 263L, 561L, 601L, 606L, 622L, 635L, 636L)), .Names = c("probe_snp_id",
     + "ref_id", "probe_align_id"), row.names = c(NA, -10L), class = "data.frame"),
     + reference = structure(list(ref_id = c(1L, 2L, 3L, 4L, 5L,
     + 6L, 7L, 8L, 9L, 11L), seqnames = c("1", "1", "1", "1", "1",
     + "1", "1", "1", "1", "1"), start = c(4785683L, 4785703L, 8595537L,
     + 8682000L, 10719780L, 12990759L, 13114284L, 13122474L, 13125617L,
     + 13150850L), end = c(4785683L, 4785703L, 8595537L, 8682000L,
     + 10719780L, 12990759L, 13114284L, 13122474L, 13125617L, 13150850L
     + ), filter = c("TRUE", "TRUE", "TRUE", "TRUE", "TRUE", "TRUE",
     + "TRUE", "TRUE", "TRUE", "TRUE"), vcf_annot_id = c(1L, 1L,
     + 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L)), .Names = c("ref_id", "seqnames",
     + "start", "end", "filter", "vcf_annot_id"), row.names = c(NA,
     + -10L), class = "data.frame"), vcf_annot = structure(list(
     + vcf_annot_id = 1L, vcf_name = "/Users/bottomly/Desktop/resources/vcfs/mgp.v3.snps.rsIDdbSNPv137.vcf.gz",
     + type = "SNV"), .Names = c("vcf_annot_id", "vcf_name",
     + "type"), row.names = c(NA, -1L), class = "data.frame")), .Names = c("allele",
     + "genotype", "probe_align", "probe_info", "probe_to_snp", "reference",
     + "vcf_annot")))
     >
     > test.schema.2 <- list(probe_info=list(db.cols=c("probe_ind", "fasta_name", "probe_id", "align_status"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "TEXT"),
     + db.constr="CONSTRAINT probe_idx UNIQUE (fasta_name)",
     + dta.func=function(x) x, should.ignore=FALSE, foreign.keys=NULL),
     + probe_align=list(db.cols=c("probe_align_id", "probe_chr", "probe_start", "probe_end", "probe_ind"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "INTEGER"),
     + db.constr="CONSTRAINT geno_idx UNIQUE (probe_chr, probe_start, probe_end, probe_ind)",
     + dta.func=function(x) x, should.ignore=FALSE, foreign.keys=list(probe_info=list(local.keys="probe_ind", ext.keys="fasta_name"))),
     + vcf_annot=list(db.cols=c("vcf_annot_id", "vcf_name", "type"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "TEXT"),
     + db.constr="CONSTRAINT probe_idx UNIQUE (vcf_name, type)",
     + dta.func=function(x) x,
     + should.ignore=TRUE, foreign.keys=NULL),
     + reference=list(db.cols=c("ref_id", "seqnames", "start", "end", "filter", "vcf_annot_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
     + db.constr="CONSTRAINT ref_idx UNIQUE (seqnames, start, end, vcf_annot_id)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")))),
     + allele=list(db.cols=c("allele_id", "alleles", "allele_num", "ref_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER"),
     + db.constr="CONSTRAINT alelle_idx UNIQUE (alleles, allele_num, ref_id)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
     + reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
     + genotype=list(db.cols=c("geno_id", "geno_chr", "allele_num","strain", "ref_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
     + db.constr="CONSTRAINT geno_idx UNIQUE (ref_id, strain, geno_chr, allele_num)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
     + reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
     + probe_to_snp=list(db.cols=c("probe_snp_id", "ref_id", "probe_align_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER"),
     + db.constr="CONSTRAINT p_s_idx UNIQUE (ref_id, probe_align_id)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
     + reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")),
     + probe_align=list(local.keys="probe_align_id", ext.keys=c("probe_chr", "probe_start", "probe_end")))))
     >
     >
     >
     >
     >
     > test_dir("testthat")
     v | OK F W S | Context
    
     - | 1 | 0
     \ | 2 | 0
     | | 3 | 0
     / | 4 | 0
     - | 5 | 0
     \ | 6 | 0
     | | 7 | 0
     / | 8 | 0
     - | 9 | 0
     \ | 10 | 0
     | | 11 | 0
     / | 12 | 0
     - | 13 | 0
     \ | 14 | 0
     | | 15 | 0
     / | 16 | 0
     - | 17 | 0
     \ | 18 | 0
     | | 19 | 0
     / | 20 | 0
     - | 21 | 0
     \ | 22 | 0
     | | 23 | 0
     / | 24 | 0
     - | 25 | 0
     \ | 26 | 0
     | | 27 | 0
     / | 28 | 0
     - | 29 | 0
     \ | 30 | 0
     | | 31 | 0
     / | 32 | 0
     - | 33 | 0
     \ | 34 | 0
     | | 35 | 0
     / | 36 | 0
     - | 37 | 0
     \ | 38 | 0
     | | 39 | 0
     / | 40 | 0
     - | 41 | 0
     \ | 42 | 0
     | | 43 | 0
     / | 44 | 0
     - | 45 | 0
     \ | 46 | 0
     | | 47 | 0
     / | 48 | 0
     - | 49 | 0
     \ | 50 | 0
     | | 51 | 0
     / | 52 | 0
     - | 53 | 0
     \ | 54 | 0
     | | 55 | 0
     / | 56 | 0
     - | 57 | 0
     \ | 58 | 0
     | | 59 | 0
     / | 60 | 0
     - | 61 | 0
     \ | 62 | 0
     | | 63 | 0
     / | 64 | 0
     - | 65 | 0
     \ | 66 | 0
     | | 67 | 0
     / | 68 | 0
     - | 69 | 0
     \ | 70 | 0
     | | 71 | 0
     / | 72 | 0
     - | 73 | 0
     \ | 74 | 0
     | | 75 | 0
     / | 76 | 0
     - | 77 | 0
     \ | 78 | 0
     | | 79 | 0
     / | 80 | 0[1] "clinical"
     [1] "normal"
    
     - | 81 | 0
     \ | 82 | 0[1] "merge"
    
     | | 83 | 0[1] "dna"
     [1] "normal"
    
     / | 84 | 0
     - | 85 | 0[1] "merge"
    
     \ | 86 | 0[1] "samples"
     [1] "normal"
    
     | | 87 | 0
     / | 88 | 0[1] "merge"
    
     - | 89 | 0
     \ | 90 | 0[1] "clinical"
     [1] "normal"
    
     | | 91 | 0
     / | 92 | 0[1] "merge"
    
     - | 93 | 0[1] "dna"
     [1] "normal"
    
     \ | 94 | 0
     | | 95 | 0[1] "merge"
    
     / | 96 | 0[1] "samples"
     [1] "normal"
    
     - | 97 | 0
     \ | 98 | 0[1] "merge"
    
     | | 99 | 0
     / | 100 | 0[1] "clinical"
    
     - | 101 | 0[1] "dna"
    
     \ | 102 | 0
     | | 103 | 0
     / | 104 | 0
     - | 105 | 0[1] "samples"
    
     \ | 106 | 0
     | | 107 | 0
     / | 108 | 0
     - | 109 | 0
     \ | 110 | 0
     | | 111 | 0
     / | 112 | 0
     - | 113 | 0
     \ | 114 | 0
     | | 115 | 0
     / | 116 | 0
     - | 117 | 0
     \ | 118 | 0
     | | 119 | 0
     / | 120 | 0
     - | 121 | 0
     \ | 122 | 0Error in x[[method]](...) : attempt to apply non-function
     Calls: test_dir ... <Anonymous> -> o_apply -> lapply -> FUN -> <Anonymous>
     In addition: Warning message:
     call dbDisconnect() when finished working with a connection
    
     == Results =====================================================================
     Duration: 2.0 s
    
     OK: 122
     Failed: 4
     Warnings: 1
     Skipped: 0
     Execution halted
Flavor: r-devel-windows-ix86+x86_64

Version: 0.99.19
Check: tests
Result: ERROR
     Running ‘testthat.R’ [3s/3s]
    Running the tests in ‘tests/testthat.R’ failed.
    Complete output:
     > library(testthat)
     > library(Lahman)
     > library(DBI)
     > library(poplite)
     Loading required package: dplyr
    
     Attaching package: 'dplyr'
    
     The following object is masked from 'package:testthat':
    
     matches
    
     The following objects are masked from 'package:stats':
    
     filter, lag
    
     The following objects are masked from 'package:base':
    
     intersect, setdiff, setequal, union
    
    
     Attaching package: 'poplite'
    
     The following object is masked from 'package:dplyr':
    
     select
    
     The following object is masked from 'package:stats':
    
     filter
    
     >
     > test.db.1 <- function()
     + {
     + samples <- data.frame(sample_id=as.integer(sapply(1:100, function(x) rep(x,2))), wave=as.integer(sapply(1:100, function(x) 1:2)), did_collect=sample(c("Y", "N"), size=100, replace=T))
     +
     + dna <- samples[samples$did_collect == "Y",c("sample_id", "wave")]
     + dna$lab_id <- paste("dna", paste(dna$sample_id, dna$wave, sep="_"), sep="_")
     + dna$lab_id[sample.int(nrow(dna), size=10)] <- NA
     + dna$ng.ul <- abs(rnorm(n=nrow(dna), mean=146, sd=98))
     + dna$ng.ul[is.na(dna$lab_id)] <- NA
     +
     + clinical <- data.frame(sample_id=1:100, sex=sample(c("M", "F"), size=100, replace=T), age=sample(1:20, 100, replace=T), status=sample(c(0L,1L), size=100, replace=T), var_wave_1=rnorm(n=100), var_wave_2=rnorm(n=100))
     + clinical <- clinical[-sample.int(nrow(clinical), 12),]
     +
     + return(list(samples=samples, dna=dna, clinical=clinical))
     + }
     >
     > test.db.2 <- eval(structure(list(allele = structure(list(allele_id = 1:10, alleles = c(".",
     + "G", "A", ".", "A", "T", ".", "C", "A", "."), allele_num = c(-1L,
     + 0L, 1L, -1L, 0L, 1L, -1L, 0L, 1L, -1L), ref_id = c(1L, 1L, 1L,
     + 2L, 2L, 2L, 3L, 3L, 3L, 4L)), .Names = c("allele_id", "alleles",
     + "allele_num", "ref_id"), row.names = c(NA, -10L), class = "data.frame"),
     + genotype = structure(list(geno_id = c(1L, 2L, 3L, 4L, 5L,
     + 6L, 7L, 8L, 9L, 11L), geno_chr = c(1L, 1L, 1L, 1L, 1L, 1L,
     + 1L, 1L, 1L, 1L), allele_num = c(1L, 1L, 1L, 1L, 1L, 1L, 1L,
     + 1L, 1L, 1L), strain = c("NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
     + "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
     + "NODShiLtJ", "NODShiLtJ"), ref_id = c(1L, 2L, 3L, 4L, 5L,
     + 6L, 7L, 8L, 9L, 11L)), .Names = c("geno_id", "geno_chr",
     + "allele_num", "strain", "ref_id"), row.names = c(NA, -10L
     + ), class = "data.frame"), probe_align = structure(list(probe_align_id = 1:10,
     + probe_chr = c("1", "1", "1", "1", "1", "1", "1", "1",
     + "1", "1"), probe_start = c(3214633L, 3214895L, 3215576L,
     + 3216284L, 3216483L, 3216537L, 3216591L, 3421710L, 3421740L,
     + 3421808L), probe_end = c(3214657L, 3214919L, 3215600L,
     + 3216308L, 3216507L, 3216561L, 3216615L, 3421734L, 3421764L,
     + 3421832L), probe_ind = 23944:23953), .Names = c("probe_align_id",
     + "probe_chr", "probe_start", "probe_end", "probe_ind"), row.names = c(NA,
     + -10L), class = "data.frame"), probe_info = structure(list(
     + probe_ind = 1:10, fasta_name = c("chr1:3044331-3044355;+;GGGCTCAAATTCACCTGTGTTAACT",
     + "chr1:3044334-3044358;+;AGGGGGCTCAAATTCACCTGTGTTA", "chr1:3044335-3044359;+;GAGGGGGCTCAAATTCACCTGTGTT",
     + "chr1:3044336-3044360;+;GGAGGGGGCTCAAATTCACCTGTGT", "chr1:3044337-3044361;+;GGGAGGGGGCTCAAATTCACCTGTG",
     + "chr1:3044504-3044528;+;AAGGCTTGGGCTATGCGCTCTCCAG", "chr1:3044557-3044581;+;AAGGTCCTCGCTCCTCTTTCATATA",
     + "chr1:3044558-3044582;+;GAAGGTCCTCGCTCCTCTTTCATAT", "chr1:3044559-3044583;+;GGAAGGTCCTCGCTCCTCTTTCATA",
     + "chr1:3044560-3044584;+;AGGAAGGTCCTCGCTCCTCTTTCAT"),
     + probe_id = c(271822L, 866088L, 240008L, 34772L, 396933L,
     + 613322L, 984143L, 826914L, 1075207L, 160847L), align_status = c("MultiMapped",
     + "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
     + "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
     + "MultiMapped")), .Names = c("probe_ind", "fasta_name",
     + "probe_id", "align_status"), row.names = c(NA, -10L), class = "data.frame"),
     + probe_to_snp = structure(list(probe_snp_id = 1:10, ref_id = c(1L,
     + 2L, 3L, 4L, 5L, 6L, 7L, 8L, 9L, 9L), probe_align_id = c(137L,
     + 137L, 252L, 263L, 561L, 601L, 606L, 622L, 635L, 636L)), .Names = c("probe_snp_id",
     + "ref_id", "probe_align_id"), row.names = c(NA, -10L), class = "data.frame"),
     + reference = structure(list(ref_id = c(1L, 2L, 3L, 4L, 5L,
     + 6L, 7L, 8L, 9L, 11L), seqnames = c("1", "1", "1", "1", "1",
     + "1", "1", "1", "1", "1"), start = c(4785683L, 4785703L, 8595537L,
     + 8682000L, 10719780L, 12990759L, 13114284L, 13122474L, 13125617L,
     + 13150850L), end = c(4785683L, 4785703L, 8595537L, 8682000L,
     + 10719780L, 12990759L, 13114284L, 13122474L, 13125617L, 13150850L
     + ), filter = c("TRUE", "TRUE", "TRUE", "TRUE", "TRUE", "TRUE",
     + "TRUE", "TRUE", "TRUE", "TRUE"), vcf_annot_id = c(1L, 1L,
     + 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L)), .Names = c("ref_id", "seqnames",
     + "start", "end", "filter", "vcf_annot_id"), row.names = c(NA,
     + -10L), class = "data.frame"), vcf_annot = structure(list(
     + vcf_annot_id = 1L, vcf_name = "/Users/bottomly/Desktop/resources/vcfs/mgp.v3.snps.rsIDdbSNPv137.vcf.gz",
     + type = "SNV"), .Names = c("vcf_annot_id", "vcf_name",
     + "type"), row.names = c(NA, -1L), class = "data.frame")), .Names = c("allele",
     + "genotype", "probe_align", "probe_info", "probe_to_snp", "reference",
     + "vcf_annot")))
     >
     > test.schema.2 <- list(probe_info=list(db.cols=c("probe_ind", "fasta_name", "probe_id", "align_status"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "TEXT"),
     + db.constr="CONSTRAINT probe_idx UNIQUE (fasta_name)",
     + dta.func=function(x) x, should.ignore=FALSE, foreign.keys=NULL),
     + probe_align=list(db.cols=c("probe_align_id", "probe_chr", "probe_start", "probe_end", "probe_ind"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "INTEGER"),
     + db.constr="CONSTRAINT geno_idx UNIQUE (probe_chr, probe_start, probe_end, probe_ind)",
     + dta.func=function(x) x, should.ignore=FALSE, foreign.keys=list(probe_info=list(local.keys="probe_ind", ext.keys="fasta_name"))),
     + vcf_annot=list(db.cols=c("vcf_annot_id", "vcf_name", "type"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "TEXT"),
     + db.constr="CONSTRAINT probe_idx UNIQUE (vcf_name, type)",
     + dta.func=function(x) x,
     + should.ignore=TRUE, foreign.keys=NULL),
     + reference=list(db.cols=c("ref_id", "seqnames", "start", "end", "filter", "vcf_annot_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
     + db.constr="CONSTRAINT ref_idx UNIQUE (seqnames, start, end, vcf_annot_id)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")))),
     + allele=list(db.cols=c("allele_id", "alleles", "allele_num", "ref_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER"),
     + db.constr="CONSTRAINT alelle_idx UNIQUE (alleles, allele_num, ref_id)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
     + reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
     + genotype=list(db.cols=c("geno_id", "geno_chr", "allele_num","strain", "ref_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
     + db.constr="CONSTRAINT geno_idx UNIQUE (ref_id, strain, geno_chr, allele_num)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
     + reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
     + probe_to_snp=list(db.cols=c("probe_snp_id", "ref_id", "probe_align_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER"),
     + db.constr="CONSTRAINT p_s_idx UNIQUE (ref_id, probe_align_id)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
     + reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")),
     + probe_align=list(local.keys="probe_align_id", ext.keys=c("probe_chr", "probe_start", "probe_end")))))
     >
     >
     >
     >
     >
     > test_dir("testthat")
     ✔ | OK F W S | Context
    
     ⠋ | 1 | 0
     ⠙ | 2 | 0
     ⠹ | 3 | 0
     ⠸ | 4 | 0
     ⠼ | 5 | 0
     ⠴ | 6 | 0
     ⠦ | 7 | 0
     ⠧ | 8 | 0
     ⠇ | 9 | 0
     ⠏ | 10 | 0
     ⠋ | 11 | 0
     ⠙ | 12 | 0
     ⠹ | 13 | 0
     ⠸ | 14 | 0
     ⠼ | 15 | 0
     ⠴ | 16 | 0
     ⠦ | 17 | 0
     ⠧ | 18 | 0
     ⠇ | 19 | 0
     ⠏ | 20 | 0
     ⠋ | 21 | 0
     ⠙ | 22 | 0
     ⠹ | 23 | 0
     ⠸ | 24 | 0
     ⠼ | 25 | 0
     ⠴ | 26 | 0
     ⠦ | 27 | 0
     ⠧ | 28 | 0
     ⠇ | 29 | 0
     ⠏ | 30 | 0
     ⠋ | 31 | 0
     ⠙ | 32 | 0
     ⠹ | 33 | 0
     ⠸ | 34 | 0
     ⠼ | 35 | 0
     ⠴ | 36 | 0
     ⠦ | 37 | 0
     ⠧ | 38 | 0
     ⠇ | 39 | 0
     ⠏ | 40 | 0
     ⠋ | 41 | 0
     ⠙ | 42 | 0
     ⠹ | 43 | 0
     ⠸ | 44 | 0
     ⠼ | 45 | 0
     ⠴ | 46 | 0
     ⠦ | 47 | 0
     ⠧ | 48 | 0
     ⠇ | 49 | 0
     ⠏ | 50 | 0
     ⠋ | 51 | 0
     ⠙ | 52 | 0
     ⠹ | 53 | 0
     ⠸ | 54 | 0
     ⠼ | 55 | 0
     ⠴ | 56 | 0
     ⠦ | 57 | 0
     ⠧ | 58 | 0
     ⠇ | 59 | 0
     ⠏ | 60 | 0
     ⠋ | 61 | 0
     ⠙ | 62 | 0
     ⠹ | 63 | 0
     ⠸ | 64 | 0
     ⠼ | 65 | 0
     ⠴ | 66 | 0
     ⠦ | 67 | 0
     ⠧ | 68 | 0
     ⠇ | 69 | 0
     ⠏ | 70 | 0
     ⠋ | 71 | 0
     ⠙ | 72 | 0
     ⠹ | 73 | 0
     ⠸ | 74 | 0
     ⠼ | 75 | 0
     ⠴ | 76 | 0
     ⠦ | 77 | 0
     ⠧ | 78 | 0
     ⠇ | 79 | 0
     ⠏ | 80 | 0[1] "clinical"
     [1] "normal"
    
     ⠋ | 81 | 0
     ⠙ | 82 | 0[1] "merge"
    
     ⠹ | 83 | 0[1] "dna"
     [1] "normal"
    
     ⠸ | 84 | 0
     ⠼ | 85 | 0[1] "merge"
    
     ⠴ | 86 | 0[1] "samples"
     [1] "normal"
    
     ⠦ | 87 | 0
     ⠧ | 88 | 0[1] "merge"
    
     ⠇ | 89 | 0
     ⠏ | 90 | 0[1] "clinical"
     [1] "normal"
    
     ⠋ | 91 | 0
     ⠙ | 92 | 0[1] "merge"
    
     ⠹ | 93 | 0[1] "dna"
     [1] "normal"
    
     ⠸ | 94 | 0
     ⠼ | 95 | 0[1] "merge"
    
     ⠴ | 96 | 0[1] "samples"
     [1] "normal"
    
     ⠦ | 97 | 0
     ⠧ | 98 | 0[1] "merge"
    
     ⠇ | 99 | 0
     ⠏ | 100 | 0[1] "clinical"
    
     ⠋ | 101 | 0[1] "dna"
    
     ⠙ | 102 | 0
     ⠹ | 103 | 0
     ⠸ | 104 | 0
     ⠼ | 105 | 0[1] "samples"
    
     ⠴ | 106 | 0
     ⠦ | 107 | 0
     ⠧ | 108 | 0
     ⠇ | 109 | 0
     ⠏ | 110 | 0
     ⠋ | 111 | 0
     ⠙ | 112 | 0
     ⠹ | 113 | 0
     ⠸ | 114 | 0
     ⠼ | 115 | 0
     ⠴ | 116 | 0
     ⠦ | 117 | 0
     ⠧ | 118 | 0
     ⠇ | 119 | 0
     ⠏ | 120 | 0
     ⠋ | 121 | 0
     ⠙ | 122 | 0Error in x[[method]](...) : attempt to apply non-function
     Calls: test_dir ... <Anonymous> -> o_apply -> lapply -> FUN -> <Anonymous>
    
     ══ Results ═════════════════════════════════════════════════════════════════════
     Duration: 1.7 s
    
     OK: 122
     Failed: 4
     Warnings: 1
     Skipped: 0
     Execution halted
Flavors: r-patched-linux-x86_64, r-release-linux-x86_64

Version: 0.99.19
Check: tests
Result: ERROR
     Running ‘testthat.R’
    Running the tests in ‘tests/testthat.R’ failed.
    Complete output:
     > library(testthat)
     > library(Lahman)
     > library(DBI)
     > library(poplite)
     Loading required package: dplyr
    
     Attaching package: 'dplyr'
    
     The following object is masked from 'package:testthat':
    
     matches
    
     The following objects are masked from 'package:stats':
    
     filter, lag
    
     The following objects are masked from 'package:base':
    
     intersect, setdiff, setequal, union
    
    
     Attaching package: 'poplite'
    
     The following object is masked from 'package:dplyr':
    
     select
    
     The following object is masked from 'package:stats':
    
     filter
    
     >
     > test.db.1 <- function()
     + {
     + samples <- data.frame(sample_id=as.integer(sapply(1:100, function(x) rep(x,2))), wave=as.integer(sapply(1:100, function(x) 1:2)), did_collect=sample(c("Y", "N"), size=100, replace=T))
     +
     + dna <- samples[samples$did_collect == "Y",c("sample_id", "wave")]
     + dna$lab_id <- paste("dna", paste(dna$sample_id, dna$wave, sep="_"), sep="_")
     + dna$lab_id[sample.int(nrow(dna), size=10)] <- NA
     + dna$ng.ul <- abs(rnorm(n=nrow(dna), mean=146, sd=98))
     + dna$ng.ul[is.na(dna$lab_id)] <- NA
     +
     + clinical <- data.frame(sample_id=1:100, sex=sample(c("M", "F"), size=100, replace=T), age=sample(1:20, 100, replace=T), status=sample(c(0L,1L), size=100, replace=T), var_wave_1=rnorm(n=100), var_wave_2=rnorm(n=100))
     + clinical <- clinical[-sample.int(nrow(clinical), 12),]
     +
     + return(list(samples=samples, dna=dna, clinical=clinical))
     + }
     >
     > test.db.2 <- eval(structure(list(allele = structure(list(allele_id = 1:10, alleles = c(".",
     + "G", "A", ".", "A", "T", ".", "C", "A", "."), allele_num = c(-1L,
     + 0L, 1L, -1L, 0L, 1L, -1L, 0L, 1L, -1L), ref_id = c(1L, 1L, 1L,
     + 2L, 2L, 2L, 3L, 3L, 3L, 4L)), .Names = c("allele_id", "alleles",
     + "allele_num", "ref_id"), row.names = c(NA, -10L), class = "data.frame"),
     + genotype = structure(list(geno_id = c(1L, 2L, 3L, 4L, 5L,
     + 6L, 7L, 8L, 9L, 11L), geno_chr = c(1L, 1L, 1L, 1L, 1L, 1L,
     + 1L, 1L, 1L, 1L), allele_num = c(1L, 1L, 1L, 1L, 1L, 1L, 1L,
     + 1L, 1L, 1L), strain = c("NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
     + "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
     + "NODShiLtJ", "NODShiLtJ"), ref_id = c(1L, 2L, 3L, 4L, 5L,
     + 6L, 7L, 8L, 9L, 11L)), .Names = c("geno_id", "geno_chr",
     + "allele_num", "strain", "ref_id"), row.names = c(NA, -10L
     + ), class = "data.frame"), probe_align = structure(list(probe_align_id = 1:10,
     + probe_chr = c("1", "1", "1", "1", "1", "1", "1", "1",
     + "1", "1"), probe_start = c(3214633L, 3214895L, 3215576L,
     + 3216284L, 3216483L, 3216537L, 3216591L, 3421710L, 3421740L,
     + 3421808L), probe_end = c(3214657L, 3214919L, 3215600L,
     + 3216308L, 3216507L, 3216561L, 3216615L, 3421734L, 3421764L,
     + 3421832L), probe_ind = 23944:23953), .Names = c("probe_align_id",
     + "probe_chr", "probe_start", "probe_end", "probe_ind"), row.names = c(NA,
     + -10L), class = "data.frame"), probe_info = structure(list(
     + probe_ind = 1:10, fasta_name = c("chr1:3044331-3044355;+;GGGCTCAAATTCACCTGTGTTAACT",
     + "chr1:3044334-3044358;+;AGGGGGCTCAAATTCACCTGTGTTA", "chr1:3044335-3044359;+;GAGGGGGCTCAAATTCACCTGTGTT",
     + "chr1:3044336-3044360;+;GGAGGGGGCTCAAATTCACCTGTGT", "chr1:3044337-3044361;+;GGGAGGGGGCTCAAATTCACCTGTG",
     + "chr1:3044504-3044528;+;AAGGCTTGGGCTATGCGCTCTCCAG", "chr1:3044557-3044581;+;AAGGTCCTCGCTCCTCTTTCATATA",
     + "chr1:3044558-3044582;+;GAAGGTCCTCGCTCCTCTTTCATAT", "chr1:3044559-3044583;+;GGAAGGTCCTCGCTCCTCTTTCATA",
     + "chr1:3044560-3044584;+;AGGAAGGTCCTCGCTCCTCTTTCAT"),
     + probe_id = c(271822L, 866088L, 240008L, 34772L, 396933L,
     + 613322L, 984143L, 826914L, 1075207L, 160847L), align_status = c("MultiMapped",
     + "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
     + "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
     + "MultiMapped")), .Names = c("probe_ind", "fasta_name",
     + "probe_id", "align_status"), row.names = c(NA, -10L), class = "data.frame"),
     + probe_to_snp = structure(list(probe_snp_id = 1:10, ref_id = c(1L,
     + 2L, 3L, 4L, 5L, 6L, 7L, 8L, 9L, 9L), probe_align_id = c(137L,
     + 137L, 252L, 263L, 561L, 601L, 606L, 622L, 635L, 636L)), .Names = c("probe_snp_id",
     + "ref_id", "probe_align_id"), row.names = c(NA, -10L), class = "data.frame"),
     + reference = structure(list(ref_id = c(1L, 2L, 3L, 4L, 5L,
     + 6L, 7L, 8L, 9L, 11L), seqnames = c("1", "1", "1", "1", "1",
     + "1", "1", "1", "1", "1"), start = c(4785683L, 4785703L, 8595537L,
     + 8682000L, 10719780L, 12990759L, 13114284L, 13122474L, 13125617L,
     + 13150850L), end = c(4785683L, 4785703L, 8595537L, 8682000L,
     + 10719780L, 12990759L, 13114284L, 13122474L, 13125617L, 13150850L
     + ), filter = c("TRUE", "TRUE", "TRUE", "TRUE", "TRUE", "TRUE",
     + "TRUE", "TRUE", "TRUE", "TRUE"), vcf_annot_id = c(1L, 1L,
     + 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L)), .Names = c("ref_id", "seqnames",
     + "start", "end", "filter", "vcf_annot_id"), row.names = c(NA,
     + -10L), class = "data.frame"), vcf_annot = structure(list(
     + vcf_annot_id = 1L, vcf_name = "/Users/bottomly/Desktop/resources/vcfs/mgp.v3.snps.rsIDdbSNPv137.vcf.gz",
     + type = "SNV"), .Names = c("vcf_annot_id", "vcf_name",
     + "type"), row.names = c(NA, -1L), class = "data.frame")), .Names = c("allele",
     + "genotype", "probe_align", "probe_info", "probe_to_snp", "reference",
     + "vcf_annot")))
     >
     > test.schema.2 <- list(probe_info=list(db.cols=c("probe_ind", "fasta_name", "probe_id", "align_status"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "TEXT"),
     + db.constr="CONSTRAINT probe_idx UNIQUE (fasta_name)",
     + dta.func=function(x) x, should.ignore=FALSE, foreign.keys=NULL),
     + probe_align=list(db.cols=c("probe_align_id", "probe_chr", "probe_start", "probe_end", "probe_ind"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "INTEGER"),
     + db.constr="CONSTRAINT geno_idx UNIQUE (probe_chr, probe_start, probe_end, probe_ind)",
     + dta.func=function(x) x, should.ignore=FALSE, foreign.keys=list(probe_info=list(local.keys="probe_ind", ext.keys="fasta_name"))),
     + vcf_annot=list(db.cols=c("vcf_annot_id", "vcf_name", "type"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "TEXT"),
     + db.constr="CONSTRAINT probe_idx UNIQUE (vcf_name, type)",
     + dta.func=function(x) x,
     + should.ignore=TRUE, foreign.keys=NULL),
     + reference=list(db.cols=c("ref_id", "seqnames", "start", "end", "filter", "vcf_annot_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
     + db.constr="CONSTRAINT ref_idx UNIQUE (seqnames, start, end, vcf_annot_id)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")))),
     + allele=list(db.cols=c("allele_id", "alleles", "allele_num", "ref_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER"),
     + db.constr="CONSTRAINT alelle_idx UNIQUE (alleles, allele_num, ref_id)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
     + reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
     + genotype=list(db.cols=c("geno_id", "geno_chr", "allele_num","strain", "ref_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
     + db.constr="CONSTRAINT geno_idx UNIQUE (ref_id, strain, geno_chr, allele_num)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
     + reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
     + probe_to_snp=list(db.cols=c("probe_snp_id", "ref_id", "probe_align_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER"),
     + db.constr="CONSTRAINT p_s_idx UNIQUE (ref_id, probe_align_id)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
     + reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")),
     + probe_align=list(local.keys="probe_align_id", ext.keys=c("probe_chr", "probe_start", "probe_end")))))
     >
     >
     >
     >
     >
     > test_dir("testthat")
     ✔ | OK F W S | Context
    
     ⠋ | 1 | 0
     ⠙ | 2 | 0
     ⠹ | 3 | 0
     ⠸ | 4 | 0
     ⠼ | 5 | 0
     ⠴ | 6 | 0
     ⠦ | 7 | 0
     ⠧ | 8 | 0
     ⠇ | 9 | 0
     ⠏ | 10 | 0
     ⠋ | 11 | 0
     ⠙ | 12 | 0
     ⠹ | 13 | 0
     ⠸ | 14 | 0
     ⠼ | 15 | 0
     ⠴ | 16 | 0
     ⠦ | 17 | 0
     ⠧ | 18 | 0
     ⠇ | 19 | 0
     ⠏ | 20 | 0
     ⠋ | 21 | 0
     ⠙ | 22 | 0
     ⠹ | 23 | 0
     ⠸ | 24 | 0
     ⠼ | 25 | 0
     ⠴ | 26 | 0
     ⠦ | 27 | 0
     ⠧ | 28 | 0
     ⠇ | 29 | 0
     ⠏ | 30 | 0
     ⠋ | 31 | 0
     ⠙ | 32 | 0
     ⠹ | 33 | 0
     ⠸ | 34 | 0
     ⠼ | 35 | 0
     ⠴ | 36 | 0
     ⠦ | 37 | 0
     ⠧ | 38 | 0
     ⠇ | 39 | 0
     ⠏ | 40 | 0
     ⠋ | 41 | 0
     ⠙ | 42 | 0
     ⠹ | 43 | 0
     ⠸ | 44 | 0
     ⠼ | 45 | 0
     ⠴ | 46 | 0
     ⠦ | 47 | 0
     ⠧ | 48 | 0
     ⠇ | 49 | 0
     ⠏ | 50 | 0
     ⠋ | 51 | 0
     ⠙ | 52 | 0
     ⠹ | 53 | 0
     ⠸ | 54 | 0
     ⠼ | 55 | 0
     ⠴ | 56 | 0
     ⠦ | 57 | 0
     ⠧ | 58 | 0
     ⠇ | 59 | 0
     ⠏ | 60 | 0
     ⠋ | 61 | 0
     ⠙ | 62 | 0
     ⠹ | 63 | 0
     ⠸ | 64 | 0
     ⠼ | 65 | 0
     ⠴ | 66 | 0
     ⠦ | 67 | 0
     ⠧ | 68 | 0
     ⠇ | 69 | 0
     ⠏ | 70 | 0
     ⠋ | 71 | 0
     ⠙ | 72 | 0
     ⠹ | 73 | 0
     ⠸ | 74 | 0
     ⠼ | 75 | 0
     ⠴ | 76 | 0
     ⠦ | 77 | 0
     ⠧ | 78 | 0
     ⠇ | 79 | 0
     ⠏ | 80 | 0[1] "clinical"
     [1] "normal"
    
     ⠋ | 81 | 0
     ⠙ | 82 | 0[1] "merge"
    
     ⠹ | 83 | 0[1] "dna"
     [1] "normal"
    
     ⠸ | 84 | 0
     ⠼ | 85 | 0[1] "merge"
    
     ⠴ | 86 | 0[1] "samples"
     [1] "normal"
    
     ⠦ | 87 | 0
     ⠧ | 88 | 0[1] "merge"
    
     ⠇ | 89 | 0
     ⠏ | 90 | 0[1] "clinical"
     [1] "normal"
    
     ⠋ | 91 | 0
     ⠙ | 92 | 0[1] "merge"
    
     ⠹ | 93 | 0[1] "dna"
     [1] "normal"
    
     ⠸ | 94 | 0
     ⠼ | 95 | 0[1] "merge"
    
     ⠴ | 96 | 0[1] "samples"
     [1] "normal"
    
     ⠦ | 97 | 0
     ⠧ | 98 | 0[1] "merge"
    
     ⠇ | 99 | 0
     ⠏ | 100 | 0[1] "clinical"
    
     ⠋ | 101 | 0[1] "dna"
    
     ⠙ | 102 | 0
     ⠹ | 103 | 0
     ⠸ | 104 | 0
     ⠼ | 105 | 0[1] "samples"
    
     ⠴ | 106 | 0
     ⠦ | 107 | 0
     ⠧ | 108 | 0
     ⠇ | 109 | 0
     ⠏ | 110 | 0
     ⠋ | 111 | 0
     ⠙ | 112 | 0
     ⠹ | 113 | 0
     ⠸ | 114 | 0
     ⠼ | 115 | 0
     ⠴ | 116 | 0
     ⠦ | 117 | 0
     ⠧ | 118 | 0
     ⠇ | 119 | 0
     ⠏ | 120 | 0
     ⠋ | 121 | 0
     ⠙ | 122 | 0Error in x[[method]](...) : attempt to apply non-function
     Calls: test_dir ... <Anonymous> -> o_apply -> lapply -> FUN -> <Anonymous>
    
     ══ Results ═════════════════════════════════════════════════════════════════════
     Duration: 2.9 s
    
     OK: 122
     Failed: 4
     Warnings: 1
     Skipped: 0
     Execution halted
Flavor: r-patched-solaris-x86

Version: 0.99.19
Check: package dependencies
Result: NOTE
    Package suggested but not available for checking: ‘VariantAnnotation’
Flavors: r-release-osx-x86_64, r-oldrel-osx-x86_64

Version: 0.99.19
Check: running R code from vignettes
Result: WARN
    Errors in running code in vignettes:
    when running code in ‘poplite.Rnw’
     ...
     8 8 8 18 0 1.68 0.535 2 F
     9 9 9 20 1 0.911 -0.555 2 F
    10 10 10 12 1 0.237 1.78 1 M
    # ... with more rows
    
    > library(VariantAnnotation)
    
     When sourcing ‘poplite.R’:
    Error: there is no package called ‘VariantAnnotation’
    Execution halted
Flavor: r-release-osx-x86_64

Version: 0.99.19
Check: re-building of vignette outputs
Result: NOTE
    Error in re-building vignettes:
     ...
    
     select
    
    The following object is masked from ‘package:stats’:
    
     filter
    
    Error in makeSchemaFromData(dna, "dna") :
     ERROR: The names of the supplied data.frame need to be modified for the database see correct.df.names
    Starting clinical
    Starting samples
    Starting dna
    Warning: call dbDisconnect() when finished working with a connection
    Error in filter_.Database(.data, .dots = compat_as_lazy_dots(...)) :
     ERROR: Cannot uniquely map columns to table, try using: tableX.columnY
    Starting gender
    Starting clinical
    Starting samples
    Starting dna
    
    Error: processing vignette 'poplite.Rnw' failed with diagnostics:
     chunk 15
    Error in library(VariantAnnotation) :
     there is no package called ‘VariantAnnotation’
    Execution halted
Flavors: r-release-osx-x86_64, r-oldrel-osx-x86_64

Version: 0.99.19
Check: tests
Result: ERROR
     Running 'testthat.R' [4s]
    Running the tests in 'tests/testthat.R' failed.
    Complete output:
     > library(testthat)
     > library(Lahman)
     > library(DBI)
     > library(poplite)
     Loading required package: dplyr
    
     Attaching package: 'dplyr'
    
     The following object is masked from 'package:testthat':
    
     matches
    
     The following objects are masked from 'package:stats':
    
     filter, lag
    
     The following objects are masked from 'package:base':
    
     intersect, setdiff, setequal, union
    
    
     Attaching package: 'poplite'
    
     The following object is masked from 'package:dplyr':
    
     select
    
     The following object is masked from 'package:stats':
    
     filter
    
     >
     > test.db.1 <- function()
     + {
     + samples <- data.frame(sample_id=as.integer(sapply(1:100, function(x) rep(x,2))), wave=as.integer(sapply(1:100, function(x) 1:2)), did_collect=sample(c("Y", "N"), size=100, replace=T))
     +
     + dna <- samples[samples$did_collect == "Y",c("sample_id", "wave")]
     + dna$lab_id <- paste("dna", paste(dna$sample_id, dna$wave, sep="_"), sep="_")
     + dna$lab_id[sample.int(nrow(dna), size=10)] <- NA
     + dna$ng.ul <- abs(rnorm(n=nrow(dna), mean=146, sd=98))
     + dna$ng.ul[is.na(dna$lab_id)] <- NA
     +
     + clinical <- data.frame(sample_id=1:100, sex=sample(c("M", "F"), size=100, replace=T), age=sample(1:20, 100, replace=T), status=sample(c(0L,1L), size=100, replace=T), var_wave_1=rnorm(n=100), var_wave_2=rnorm(n=100))
     + clinical <- clinical[-sample.int(nrow(clinical), 12),]
     +
     + return(list(samples=samples, dna=dna, clinical=clinical))
     + }
     >
     > test.db.2 <- eval(structure(list(allele = structure(list(allele_id = 1:10, alleles = c(".",
     + "G", "A", ".", "A", "T", ".", "C", "A", "."), allele_num = c(-1L,
     + 0L, 1L, -1L, 0L, 1L, -1L, 0L, 1L, -1L), ref_id = c(1L, 1L, 1L,
     + 2L, 2L, 2L, 3L, 3L, 3L, 4L)), .Names = c("allele_id", "alleles",
     + "allele_num", "ref_id"), row.names = c(NA, -10L), class = "data.frame"),
     + genotype = structure(list(geno_id = c(1L, 2L, 3L, 4L, 5L,
     + 6L, 7L, 8L, 9L, 11L), geno_chr = c(1L, 1L, 1L, 1L, 1L, 1L,
     + 1L, 1L, 1L, 1L), allele_num = c(1L, 1L, 1L, 1L, 1L, 1L, 1L,
     + 1L, 1L, 1L), strain = c("NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
     + "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
     + "NODShiLtJ", "NODShiLtJ"), ref_id = c(1L, 2L, 3L, 4L, 5L,
     + 6L, 7L, 8L, 9L, 11L)), .Names = c("geno_id", "geno_chr",
     + "allele_num", "strain", "ref_id"), row.names = c(NA, -10L
     + ), class = "data.frame"), probe_align = structure(list(probe_align_id = 1:10,
     + probe_chr = c("1", "1", "1", "1", "1", "1", "1", "1",
     + "1", "1"), probe_start = c(3214633L, 3214895L, 3215576L,
     + 3216284L, 3216483L, 3216537L, 3216591L, 3421710L, 3421740L,
     + 3421808L), probe_end = c(3214657L, 3214919L, 3215600L,
     + 3216308L, 3216507L, 3216561L, 3216615L, 3421734L, 3421764L,
     + 3421832L), probe_ind = 23944:23953), .Names = c("probe_align_id",
     + "probe_chr", "probe_start", "probe_end", "probe_ind"), row.names = c(NA,
     + -10L), class = "data.frame"), probe_info = structure(list(
     + probe_ind = 1:10, fasta_name = c("chr1:3044331-3044355;+;GGGCTCAAATTCACCTGTGTTAACT",
     + "chr1:3044334-3044358;+;AGGGGGCTCAAATTCACCTGTGTTA", "chr1:3044335-3044359;+;GAGGGGGCTCAAATTCACCTGTGTT",
     + "chr1:3044336-3044360;+;GGAGGGGGCTCAAATTCACCTGTGT", "chr1:3044337-3044361;+;GGGAGGGGGCTCAAATTCACCTGTG",
     + "chr1:3044504-3044528;+;AAGGCTTGGGCTATGCGCTCTCCAG", "chr1:3044557-3044581;+;AAGGTCCTCGCTCCTCTTTCATATA",
     + "chr1:3044558-3044582;+;GAAGGTCCTCGCTCCTCTTTCATAT", "chr1:3044559-3044583;+;GGAAGGTCCTCGCTCCTCTTTCATA",
     + "chr1:3044560-3044584;+;AGGAAGGTCCTCGCTCCTCTTTCAT"),
     + probe_id = c(271822L, 866088L, 240008L, 34772L, 396933L,
     + 613322L, 984143L, 826914L, 1075207L, 160847L), align_status = c("MultiMapped",
     + "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
     + "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
     + "MultiMapped")), .Names = c("probe_ind", "fasta_name",
     + "probe_id", "align_status"), row.names = c(NA, -10L), class = "data.frame"),
     + probe_to_snp = structure(list(probe_snp_id = 1:10, ref_id = c(1L,
     + 2L, 3L, 4L, 5L, 6L, 7L, 8L, 9L, 9L), probe_align_id = c(137L,
     + 137L, 252L, 263L, 561L, 601L, 606L, 622L, 635L, 636L)), .Names = c("probe_snp_id",
     + "ref_id", "probe_align_id"), row.names = c(NA, -10L), class = "data.frame"),
     + reference = structure(list(ref_id = c(1L, 2L, 3L, 4L, 5L,
     + 6L, 7L, 8L, 9L, 11L), seqnames = c("1", "1", "1", "1", "1",
     + "1", "1", "1", "1", "1"), start = c(4785683L, 4785703L, 8595537L,
     + 8682000L, 10719780L, 12990759L, 13114284L, 13122474L, 13125617L,
     + 13150850L), end = c(4785683L, 4785703L, 8595537L, 8682000L,
     + 10719780L, 12990759L, 13114284L, 13122474L, 13125617L, 13150850L
     + ), filter = c("TRUE", "TRUE", "TRUE", "TRUE", "TRUE", "TRUE",
     + "TRUE", "TRUE", "TRUE", "TRUE"), vcf_annot_id = c(1L, 1L,
     + 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L)), .Names = c("ref_id", "seqnames",
     + "start", "end", "filter", "vcf_annot_id"), row.names = c(NA,
     + -10L), class = "data.frame"), vcf_annot = structure(list(
     + vcf_annot_id = 1L, vcf_name = "/Users/bottomly/Desktop/resources/vcfs/mgp.v3.snps.rsIDdbSNPv137.vcf.gz",
     + type = "SNV"), .Names = c("vcf_annot_id", "vcf_name",
     + "type"), row.names = c(NA, -1L), class = "data.frame")), .Names = c("allele",
     + "genotype", "probe_align", "probe_info", "probe_to_snp", "reference",
     + "vcf_annot")))
     >
     > test.schema.2 <- list(probe_info=list(db.cols=c("probe_ind", "fasta_name", "probe_id", "align_status"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "TEXT"),
     + db.constr="CONSTRAINT probe_idx UNIQUE (fasta_name)",
     + dta.func=function(x) x, should.ignore=FALSE, foreign.keys=NULL),
     + probe_align=list(db.cols=c("probe_align_id", "probe_chr", "probe_start", "probe_end", "probe_ind"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "INTEGER"),
     + db.constr="CONSTRAINT geno_idx UNIQUE (probe_chr, probe_start, probe_end, probe_ind)",
     + dta.func=function(x) x, should.ignore=FALSE, foreign.keys=list(probe_info=list(local.keys="probe_ind", ext.keys="fasta_name"))),
     + vcf_annot=list(db.cols=c("vcf_annot_id", "vcf_name", "type"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "TEXT"),
     + db.constr="CONSTRAINT probe_idx UNIQUE (vcf_name, type)",
     + dta.func=function(x) x,
     + should.ignore=TRUE, foreign.keys=NULL),
     + reference=list(db.cols=c("ref_id", "seqnames", "start", "end", "filter", "vcf_annot_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
     + db.constr="CONSTRAINT ref_idx UNIQUE (seqnames, start, end, vcf_annot_id)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")))),
     + allele=list(db.cols=c("allele_id", "alleles", "allele_num", "ref_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER"),
     + db.constr="CONSTRAINT alelle_idx UNIQUE (alleles, allele_num, ref_id)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
     + reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
     + genotype=list(db.cols=c("geno_id", "geno_chr", "allele_num","strain", "ref_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
     + db.constr="CONSTRAINT geno_idx UNIQUE (ref_id, strain, geno_chr, allele_num)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
     + reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
     + probe_to_snp=list(db.cols=c("probe_snp_id", "ref_id", "probe_align_id"),
     + db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER"),
     + db.constr="CONSTRAINT p_s_idx UNIQUE (ref_id, probe_align_id)",
     + dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
     + reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")),
     + probe_align=list(local.keys="probe_align_id", ext.keys=c("probe_chr", "probe_start", "probe_end")))))
     >
     >
     >
     >
     >
     > test_dir("testthat")
     v | OK F W S | Context
    
     - | 1 | 0
     \ | 2 | 0
     | | 3 | 0
     / | 4 | 0
     - | 5 | 0
     \ | 6 | 0
     | | 7 | 0
     / | 8 | 0
     - | 9 | 0
     \ | 10 | 0
     | | 11 | 0
     / | 12 | 0
     - | 13 | 0
     \ | 14 | 0
     | | 15 | 0
     / | 16 | 0
     - | 17 | 0
     \ | 18 | 0
     | | 19 | 0
     / | 20 | 0
     - | 21 | 0
     \ | 22 | 0
     | | 23 | 0
     / | 24 | 0
     - | 25 | 0
     \ | 26 | 0
     | | 27 | 0
     / | 28 | 0
     - | 29 | 0
     \ | 30 | 0
     | | 31 | 0
     / | 32 | 0
     - | 33 | 0
     \ | 34 | 0
     | | 35 | 0
     / | 36 | 0
     - | 37 | 0
     \ | 38 | 0
     | | 39 | 0
     / | 40 | 0
     - | 41 | 0
     \ | 42 | 0
     | | 43 | 0
     / | 44 | 0
     - | 45 | 0
     \ | 46 | 0
     | | 47 | 0
     / | 48 | 0
     - | 49 | 0
     \ | 50 | 0
     | | 51 | 0
     / | 52 | 0
     - | 53 | 0
     \ | 54 | 0
     | | 55 | 0
     / | 56 | 0
     - | 57 | 0
     \ | 58 | 0
     | | 59 | 0
     / | 60 | 0
     - | 61 | 0
     \ | 62 | 0
     | | 63 | 0
     / | 64 | 0
     - | 65 | 0
     \ | 66 | 0
     | | 67 | 0
     / | 68 | 0
     - | 69 | 0
     \ | 70 | 0
     | | 71 | 0
     / | 72 | 0
     - | 73 | 0
     \ | 74 | 0
     | | 75 | 0
     / | 76 | 0
     - | 77 | 0
     \ | 78 | 0
     | | 79 | 0
     / | 80 | 0[1] "clinical"
     [1] "normal"
    
     - | 81 | 0
     \ | 82 | 0[1] "merge"
    
     | | 83 | 0[1] "dna"
     [1] "normal"
    
     / | 84 | 0
     - | 85 | 0[1] "merge"
    
     \ | 86 | 0[1] "samples"
     [1] "normal"
    
     | | 87 | 0
     / | 88 | 0[1] "merge"
    
     - | 89 | 0
     \ | 90 | 0[1] "clinical"
     [1] "normal"
    
     | | 91 | 0
     / | 92 | 0[1] "merge"
    
     - | 93 | 0[1] "dna"
     [1] "normal"
    
     \ | 94 | 0
     | | 95 | 0[1] "merge"
    
     / | 96 | 0[1] "samples"
     [1] "normal"
    
     - | 97 | 0
     \ | 98 | 0[1] "merge"
    
     | | 99 | 0
     / | 100 | 0[1] "clinical"
    
     - | 101 | 0[1] "dna"
    
     \ | 102 | 0
     | | 103 | 0
     / | 104 | 0
     - | 105 | 0[1] "samples"
    
     \ | 106 | 0
     | | 107 | 0
     / | 108 | 0
     - | 109 | 0
     \ | 110 | 0
     | | 111 | 0
     / | 112 | 0
     - | 113 | 0
     \ | 114 | 0
     | | 115 | 0
     / | 116 | 0
     - | 117 | 0
     \ | 118 | 0
     | | 119 | 0
     / | 120 | 0
     - | 121 | 0
     \ | 122 | 0Error in x[[method]](...) : attempt to apply non-function
     Calls: test_dir ... <Anonymous> -> o_apply -> lapply -> FUN -> <Anonymous>
     In addition: Warning message:
     call dbDisconnect() when finished working with a connection
    
     == Results =====================================================================
     Duration: 2.2 s
    
     OK: 122
     Failed: 4
     Warnings: 1
     Skipped: 0
     Execution halted
Flavor: r-oldrel-windows-ix86+x86_64

Version: 0.99.19
Check: running R code from vignettes
Result: WARN
    Errors in running code in vignettes:
    when running code in ‘poplite.Rnw’
     ...
     8 8 8 18 0 1.6844357 0.53539884 2 F
     9 9 9 20 1 0.9113913 -0.55527835 2 F
    10 10 10 12 1 0.2374303 1.77950291 1 M
    # ... with more rows
    
    > library(VariantAnnotation)
    
     When sourcing ‘poplite.R’:
    Error: there is no package called ‘VariantAnnotation’
    Execution halted
Flavor: r-oldrel-osx-x86_64