bold is an R package to connect to BOLD Systems via their API. Functions in bold let you search for sequence data, specimen data, sequence + specimen data, and download raw trace files.

bold info

Using bold

Install

Install bold from CRAN

install.packages("bold")

Or install the development version from GitHub

devtools::install_github("ropensci/bold")

Load the package

library("bold")

Search for taxonomic names via names

bold_tax_name searches for names with names.

bold_tax_name(name = 'Diplura')
#>     input  taxid   taxon tax_rank tax_division parentid       parentname
#> 1 Diplura 591238 Diplura    order      Animals       82          Insecta
#> 2 Diplura 603673 Diplura    genus     Protists    53974 Scytosiphonaceae
#>   taxonrep
#> 1  Diplura
#> 2     <NA>
bold_tax_name(name = c('Diplura', 'Osmia'))
#>     input  taxid   taxon tax_rank tax_division parentid       parentname
#> 1 Diplura 591238 Diplura    order      Animals       82          Insecta
#> 2 Diplura 603673 Diplura    genus     Protists    53974 Scytosiphonaceae
#> 3   Osmia   4940   Osmia    genus      Animals     4962     Megachilinae
#>   taxonrep
#> 1  Diplura
#> 2     <NA>
#> 3    Osmia

Search for taxonomic names via BOLD identifiers

bold_tax_id searches for names with BOLD identifiers.

bold_tax_id(id = 88899)
#>   input taxid   taxon tax_rank tax_division parentid parentname
#> 1 88899 88899 Momotus    genus      Animals    88898  Momotidae
bold_tax_id(id = c(88899, 125295))
#>    input  taxid      taxon tax_rank tax_division parentid parentname
#> 1  88899  88899    Momotus    genus      Animals    88898  Momotidae
#> 2 125295 125295 Helianthus    genus       Plants   100962 Asteraceae

Search for sequence data only

The BOLD sequence API gives back sequence data, with a bit of metadata.

The default is to get a list back

bold_seq(taxon = 'Coelioxys')[1:2]
#> [[1]]
#> [[1]]$id
#> [1] "FBAPB491-09"
#>
#> [[1]]$name
#> [1] "Coelioxys conica"
#>
#> [[1]]$gene
#> [1] "FBAPB491-09"
#>
#> [[1]]$sequence
#> [1] "---------------------ACCTCTTTAAGAATAATTATTCGTATAGAAATAAGAATTCCAGGATCTTGAATTAATAATGATCAAATTTATAACTCCTTTATTACAGCACATGCATTTTTAATAATTTTTTTTTTAGTTATACCTTTTCTTATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGATCACCAGATATAGCTTTCCCACGAATAAATAATATTAGATTTTGATTATTACCTCCTTCTTTATTAATATTATTATTAAGTAATTTAATAAATCCCAGACCAGGAACAGGCTGAACAGTTTATCCTCCTTTATCTTTATACACATACCACCCTTCTCCCTCAGTTGATTTAGCAATTTTTTCACTACATCTATCAGGAATCTCTTCTATTATTGGATCTATAAATTTTATTGTTACAATTTTAATAATAAAAAACTTTTCAATAAATTATAATCAAATACCATTATTCCCATGATCTATTTTAATTACTACTATTTTATTATTATTATCACTACCTGTATTAGCTGGTGCTATTACTATATTATTATTTGATCGAAATTTAAATTCTTCTTTTTTTGACCCTATAGGAGGAGGAGACCCAATTTTATACCAACATTTA"
#>
#>
#> [[2]]
#> [[2]]$id
#> [1] "FBAPC351-10"
#>
#> [[2]]$name
#> [1] "Coelioxys afra"
#>
#> [[2]]$gene
#> [1] "FBAPC351-10"
#>
#> [[2]]$sequence
#> [1] "---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGAATAAATAATGTAAGATTTTGACTATTACCTCCCTCAATTTTCTTATTATTATCAAGAACCCTAATTAACCCAAGAGCTGGTACTGGATGAACTGTATATCCTCCTTTATCCTTATATACATTTCATGCCTCACCTTCCGTTGATTTAGCAATTTTTTCACTTCATTTATCAGGAATTTCATCAATTATTGGATCAATAAATTTTATTGTTACAATCTTAATAATAAAAAATTTTTCTTTAAATTATAGACAAATACCATTATTTTCATGATCAGTTTTAATTACTACAATTTTACTTTTATTATCATTACCAATTTTAGCTGGAGCAATTACTATACTCCTATTTGATCGAAATTTAAATACCTCATTCTTTGACCCAATAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT"

You can optionally get back the httr response object

res <- bold_seq(taxon = 'Coelioxys', response = TRUE)
res$headers
#> $date
#> [1] "Tue, 15 Sep 2015 20:02:31 GMT"
#>
#> $server
#> [1] "Apache/2.2.15 (Red Hat)"
#>
#> $`x-powered-by`
#> [1] "PHP/5.3.15"
#>
#> $`content-disposition`
#> [1] "attachment; filename=fasta.fas"
#>
#> $connection
#> [1] "close"
#>
#> $`transfer-encoding`
#> [1] "chunked"
#>
#> $`content-type`
#> [1] "application/x-download"
#>
#> attr(,"class")
#> [1] "insensitive" "list"

You can do geographic searches

bold_seq(geo = "USA")
#> [[1]]
#> [[1]]$id
#> [1] "GBAN1777-08"
#>
#> [[1]]$name
#> [1] "Macrobdella decora"
#>
#> [[1]]$gene
#> [1] "GBAN1777-08"
#>
#> [[1]]$sequence
#> [1] "---------------------------------ATTGGAATCTTGTATTTCTTATTAGGTACATGATCTGCTATAGTAGGGACCTCTATA---AGAATAATTATTCGAATTGAATTAGCTCAACCTGGGTCGTTTTTAGGAAAT---GATCAAATTTACAATACTATTGTTACTGCTCATGGATTAATTATAATTTTTTTTATAGTAATACCTATTTTAATTGGAGGGTTTGGTAATTGATTAATTCCGCTAATA---ATTGGTTCTCCTGATATAGCTTTTCCACGTCTTAATAATTTAAGATTTTGATTACTTCCGCCATCTTTAACTATACTTTTTTGTTCATCTATAGTCGAAAATGGAGTAGGTACTGGATGGACTATTTACCCTCCTTTAGCAGATAACATTGCTCATTCTGGACCTTCTGTAGATATA---GCAATTTTTTCACTTCATTTAGCTGGTGCTTCTTCTATTTTAGGTTCATTAAATTTTATTACTACTGTAGTTAATATACGATGACCAGGGATATCTATAGAGCGAATTCCTTTATTTATTTGATCCGTAATTATTACTACTGTATTGCTATTATTATCTTTACCAGTATTAGCAGCT---GCTATTTCAATATTATTAACAGATCGTAACTTAAATACTAGATTTTTTGACCCAATAGGAGGAGGGGATCCTATTTTATTCCAACATTTATTTTGATTTTTTGGCCACCCTGAAGTTTATATTTTAATTTTACCAGGATTTGGAGCTATTTCTCATGTAGTAAGTCATAACTCT---AAAAAATTAGAACCGTTTGGATCATTAGGGATATTATATGCAATAATTGGAATTGCAATTTTAGGTTTTATTGTTTGAGCACATCATATATTTACAGTAGGTCTTGATGTAGATACACGAGCTTATTTTACAGCAGCTACAATAGTTATTGCTGTTCCTACAGGAATTAAAGTATTTAGGTGATTG---GCAACT"
#>
#>
#> [[2]]
#> [[2]]$id
#> [1] "GBAN1780-08"
#>
#> [[2]]$name
#> [1] "Haemopis terrestris"
#>
#> [[2]]$gene
#> [1] "GBAN1780-08"
#>
#> [[2]]$sequence
#> [1] "---------------------------------ATTGGAACWTTWTATTTTATTTTNGGNGCTTGATCTGCTATATTNGGGATCTCAATA---AGGAATATTATTCGAATTGAGCCATCTCAACCTGGGAGATTATTAGGAAAT---GATCAATTATATAATTCATTAGTAACAGCTCATGGATTAATTATAATTTTCTTTATGGTTATGCCTATTTTGATTGGTGGGTTTGGTAATTGATTACTACCTTTAATA---ATTGGAGCCCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGTTTTTGATTATTACCACCTTCATTAATTATATTGTTAAGATCCTCTATTATTGAAAGAGGGGTAGGTACAGGTTGAACCTTATATCCTCCTTTAGCAGATAGATTATTTCATTCAGGTCCATCGGTAGATATA---GCTATTTTTTCATTACATATAGCTGGAGCATCATCTATTTTAGGCTCATTAAACTTTATTTCTACAATTATTAATATACGAATTAAAGGTATAAGATCTGATCGAGTACCTTTATTTGTATGATCAGTTGTTATTACAACAGTTCTGTTATTATTGTCTTTACCTGTTTTAGCTGCA---GCTATTACTATATTATTAACAGATCGTAATTTAAATACTACTTTTTTTGATCCTATAGGAGGTGGAGATCCAGTATTGTTTCAACACTTATTTTGATTTTTTGGTCATCCAGAAGTATATATTTTGATTTTACCAGGATTTGGAGCAATTTCTCATATTATTACAAATAATTCT---AAAAAATTGGAACCTTTTGGATCTCTTGGTATAATTTATGCTATAATTGGAATTGCAGTTTTAGGGTTTATTGTATGAGCCCATCATATATTTACTGTAGGATTAGATGTTGATACTCGAGCTTATTTTACAGCAGCTACTATAGTTATTGCTGTTCCTACTGGTATTAAAGTTTTTAGGTGATTA---GCAACA"
#>
#>
#> [[3]]
#> [[3]]$id
#> [1] "GBNM0293-06"
#>
#> [[3]]$name
#> [1] "Steinernema carpocapsae"
#>
#> [[3]]$gene
#> [1] "GBNM0293-06"
#>
#> [[3]]$sequence
#> [1] "---------------------------------------------------------------------------------ACAAGATTATCTCTTATTATTCGTTTAGAGTTGGCTCAACCTGGTCTTCTTTTGGGTAAT---GGTCAATTATATAATTCTATTATTACTGCTCATGCTATTCTTATAATTTTTTTCATAGTTATACCTAGAATAATTGGTGGTTTTGGTAATTGAATATTACCTTTAATATTGGGGGCTCCTGATATAAGTTTTCCACGTTTGAATAATTTAAGTTTTTGATTGCTACCAACTGCTATATTTTTGATTTTAGATTCTTGTTTTGTTGACACTGGTTGTGGTACTAGTTGAACTGTTTATCCTCCTTTGAGG---ACTTTAGGTCACCCTGGYAGAAGTGTAGATTTAGCTATTTTTAGTCTTCATTGTGCAGGAATTAGCTCAATTTTAGGGGCTATTAATTTTATATGTACTACAAAAAATCTTCGTAGTAGTTCTATTTCTTTGGAACATATAAGACTTTTTGTTTGGGCTGTTTTTGTTACTGTTTTTTTATTAGTTTTATCTTTACCTGTTTTAGCTGGTGCTATTACTATGCTTTTAACAGACCGTAATTTAAATACTTCTTTTTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------"
#>
#>
#> [[4]]
#> [[4]]$id
#> [1] "NEONV108-11"
#>
#> [[4]]$name
#> [1] "Aedes thelcter"
#>
#> [[4]]$gene
#> [1] "NEONV108-11"
#>
#> [[4]]$sequence
#> [1] "AACTTTATACTTCATCTTCGGAGTTTGATCAGGAATAGTTGGTACATCATTAAGAATTTTAATTCGTGCTGAATTAAGTCAACCAGGTATATTTATTGGAAATGACCAAATTTATAATGTAATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTTCCTCTAATATTAGGAGCCCCAGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGAATACTACCTCCCTCATTAACTCTTCTACTTTCAAGTAGTATAGTAGAAAATGGATCAGGAACAGGATGAACAGTTTATCCACCTCTTTCATCTGGAACTGCTCATGCAGGAGCCTCTGTTGATTTAACTATTTTTTCTCTTCATTTAGCCGGAGTTTCATCAATTTTAGGGGCTGTAAATTTTATTACTACTGTAATTAATATACGATCTGCAGGAATTACTCTTGATCGACTACCTTTATTCGTTTGATCTGTAGTAATTACAGCTGTTTTATTACTTCTTTCACTTCCTGTATTAGCTGGAGCTATTACAATACTATTAACTGATCGAAATTTAAATACATCTTTCTTTGATCCAATTGGAGGAGGAGACCCAATTTTATACCAACATTTATTT"
#>
#>
#> [[5]]
#> [[5]]$id
#> [1] "NEONV109-11"
#>
#> [[5]]$name
#> [1] "Aedes thelcter"
#>
#> [[5]]$gene
#> [1] "NEONV109-11"
#>
#> [[5]]$sequence
#> [1] "AACTTTATACTTCATCTTCGGAGTTTGATCAGGAATAGTTGGTACATCATTAAGAATTTTAATTCGTGCTGAATTAAGTCAACCAGGTATATTTATTGGAAATGACCAAATTTATAATGTAATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTTCCTCTAATATTAGGAGCCCCAGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGAATACTACCTCCCTCATTAACTCTTCTACTTTCAAGTAGTATAGTAGAAAATGGGTCAGGAACAGGATGAACAGTTTATCCACCTCTTTCATCTGGAACTGCTCATGCAGGAGCCTCTGTTGATTTAACTATTTTTTCTCTTCATTTAGCCGGAGTTTCATCAATTTTAGGGGCTGTAAATTTTATTACTACTGTAATTAATATACGATCTGCAGGAATTACTCTTGATCGACTACCTTTATTCGTTTGATCTGTAGTAATTACAGCTGTTTTATTACTTCTTTCACTTCCTGTATTAGCTGGAGCTATTACAATACTATTAACTGATCGAAATTTAAATACATCTTTCTTTGACCCAATTGGAGGGGGAGACCCAATTTTATACCAACATTTATTT"

And you can search by researcher name

bold_seq(researchers = 'Thibaud Decaens')[[1]]
#> $id
#> [1] "BGABA657-14"
#>
#> $name
#> [1] "Coleoptera"
#>
#> $gene
#> [1] "BGABA657-14"
#>
#> $sequence
#> [1] "ACACTCTATTTCATTTTCGGAGCTTGATCAGGAATAGTAGGAACTTCTTTAAGAATACTAATTCGATCTGAATTGGGAAACCCCGGCTCATTGATTGGGGATGATCAAATTTATAATGTTATTGTAACAGCCCATGCATTCATTATAATTTTTTTTATAGTAATACCGATCATAATAGGAGGTTTTGGAAATTGATTAGTCCCGCTAATATTAGGTGCCCCAGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGACTTCTTCCGCCTTCATTAACTTTACTTATTATAAGAAGAATTGTAGAAAACGGGGCGGGAACAGGATGAACAGTTTACCCACCCCTCTCTTCTAACATTGCTCATAGAGGAGCCTCTGTAGATCTTGCAATTTTTAGATTACATTTAGCCGGTGTATCATCAATTTTAGGTGCAGTTAATTTTATTACAACTATTATTAATATACGACCTAAAGGAATAACATTTGATCGCATACCTTTATTTGTATGAGCTGTAGCTTTAACTGCATTACTTTTATTATTATCTTTACCAGTATTAGCAGGTGCAATTACAATACTTTTAACTGATCGA---------------------------------------"

by taxon IDs

bold_seq(ids = c('ACRJP618-11', 'ACRJP619-11'))
#> [[1]]
#> [[1]]$id
#> [1] "ACRJP618-11"
#>
#> [[1]]$name
#> [1] "Lepidoptera"
#>
#> [[1]]$gene
#> [1] "ACRJP618-11"
#>
#> [[1]]$sequence
#> [1] "------------------------TTGAGCAGGCATAGTAGGAACTTCTCTTAGTCTTATTATTCGAACAGAATTAGGAAATCCAGGATTTTTAATTGGAGATGATCAAATCTACAATACTATTGTTACGGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCCCTTATACTAGGAGCCCCAGATATAGCTTTCCCTCGAATAAACAATATAAGTTTTTGGCTTCTTCCCCCTTCACTATTACTTTTAATTTCCAGAAGAATTGTTGAAAATGGAGCTGGAACTGGATGAACAGTTTATCCCCCACTGTCATCTAATATTGCCCATAGAGGTACATCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGTATTTCCTCTATTTTAGGAGCGATTAATTTTATTACTACAATTATTAATATACGAATTAACAGTATAAATTATGATCAAATACCACTATTTGTGTGATCAGTAGGAATTACTGCTTTACTCTTATTACTTTCTCTTCCAGTATTAGCAGGTGCTATCACTATATTATTAACGGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT"
#>
#>
#> [[2]]
#> [[2]]$id
#> [1] "ACRJP619-11"
#>
#> [[2]]$name
#> [1] "Lepidoptera"
#>
#> [[2]]$gene
#> [1] "ACRJP619-11"
#>
#> [[2]]$sequence
#> [1] "AACTTTATATTTTATTTTTGGTATTTGAGCAGGCATAGTAGGAACTTCTCTTAGTCTTATTATTCGAACAGAATTAGGAAATCCAGGATTTTTAATTGGAGATGATCAAATCTACAATACTATTGTTACGGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCCCTTATACTAGGAGCCCCAGATATAGCTTTCCCTCGAATAAACAATATAAGTTTTTGGCTTCTTCCCCCTTCACTATTACTTTTAATTTCCAGAAGAATTGTTGAAAATGGAGCTGGAACTGGATGAACAGTTTATCCCCCACTGTCATCTAATATTGCCCATAGAGGTACATCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGTATTTCCTCTATTTTAGGAGCGATTAATTTTATTACTACAATTATTAATATACGAATTAACAGTATAAATTATGATCAAATACCACTATTTGTGTGATCAGTAGGAATTACTGCTTTACTCTTATTACTTTCTCTTCCAGTATTAGCAGGTGCTATCACTATATTATTAACGGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT"

by container (containers include project codes and dataset codes)

bold_seq(container = 'ACRJP')[[1]]
#> $id
#> [1] "ACRJP003-09"
#>
#> $name
#> [1] "Lepidoptera"
#>
#> $gene
#> [1] "ACRJP003-09"
#>
#> $sequence
#> [1] "AACATTATATTTTATTTTTGGGATCTGATCTGGAATAGTAGGGACATCTTTAAGTATACTAATTCGAATAGAACTAGGAAATCCTGGATGTTTAATTGGGGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGTTTTGGCAATTGACTTGTACCATTAATATTAGGAGCCCCTGATATAGCATTTCCCCGAATAAATAATATAAGATTTTGACTTCTTCCCCCCTCATTAATTTTATTAATTTCAAGAAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTCTATCCTCCATTATCTTCTAATATTGCGCATAGAGGATCCTCTGTTGATTTAGCTATTTTCTCACTTCATTTAGCAGGAATTTCTTCTATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAATAAATAATTTACTTTTTGACCAAATACCTCTATTTGTTTGAGCAGTAGGTATTACAGCTGTTCTTCTTTTATTATCATTACCAGTATTAGCAGGAGCAATTACCATACTATTAACAGATCGTAATTTAAATACTTCTTTCTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATACCAACATTTATTT"

by bin (a bin is a Barcode Index Number)

bold_seq(bin = 'BOLD:AAA5125')[[1]]
#> $id
#> [1] "BLPAB406-06"
#>
#> $name
#> [1] "Eacles ormondei"
#>
#> $gene
#> [1] "BLPAB406-06"
#>
#> $sequence
#> [1] "AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTACTAATTCGAGCAGAATTAGGTACCCCCGGATCTTTAATTGGAGATGACCAAATTTATAATACCATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCCCTAATACTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTATTACCCCCATCTTTAACTCTTTTAATTTCTAGAAGAATTGTCGAAAATGGAGCTGGAACTGGATGAACAGTTTATCCCCCCCTTTCATCTAATATTGCTCATGGAGGCTCTTCTGTTGATTTAGCTATTTTTTCCCTTCATCTAGCTGGAATCTCATCAATTTTAGGAGCTATTAATTTTATCACAACAATCATTAATATACGACTAAATAATATAATATTTGACCAAATACCTTTATTTGTATGAGCTGTTGGTATTACAGCATTTCTTTTATTGTTATCTTTACCTGTACTAGCTGGAGCTATTACTATACTTTTAACAGATCGAAACTTAAATACATCATTTTTTGACCCAGCAGGAGGAGGAGATCCTATTCTCTATCAACATTTATTT"

And there are more ways to query, check out the docs for ?bold_seq.

Search for specimen data only

The BOLD specimen API doesn't give back sequences, only specimen data. By default you download tsv format data, which is given back to you as a data.frame

res <- bold_specimens(taxon = 'Osmia')
head(res[,1:8])
#>      processid         sampleid recordID       catalognum         fieldnum
#> 1  ASGCB261-13   BIOUG07489-F10  3955538                    BIOUG07489-F10
#> 2 BCHYM1499-13 BC ZSM HYM 19359  4005348 BC ZSM HYM 19359 BC ZSM HYM 19359
#> 3  BCHYM412-13 BC ZSM HYM 18272  3896353 BC ZSM HYM 18272 BC ZSM HYM 18272
#> 4  BCHYM413-13 BC ZSM HYM 18273  3896354 BC ZSM HYM 18273 BC ZSM HYM 18273
#> 5  FBAPB706-09 BC ZSM HYM 02181  1289067 BC ZSM HYM 02181 BC ZSM HYM 02181
#> 6  FBAPB730-09 BC ZSM HYM 02205  1289091 BC ZSM HYM 02205 BC ZSM HYM 02205
#>                         institution_storing      bin_uri phylum_taxID
#> 1         Biodiversity Institute of Ontario BOLD:AAB8874           20
#> 2 SNSB, Zoologische Staatssammlung Muenchen BOLD:AAD6282           20
#> 3 SNSB, Zoologische Staatssammlung Muenchen BOLD:AAP2416           20
#> 4 SNSB, Zoologische Staatssammlung Muenchen BOLD:AAP2416           20
#> 5 SNSB, Zoologische Staatssammlung Muenchen BOLD:AAE4126           20
#> 6 SNSB, Zoologische Staatssammlung Muenchen BOLD:AAK5820           20

You can optionally get back the data in XML format

bold_specimens(taxon = 'Osmia', format = 'xml')
<?xml version="1.0" encoding="UTF-8"?>
<bold_records  xsi:noNamespaceSchemaLocation="http://www.boldsystems.org/schemas/BOLDPublic_record.xsd"  xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance">
  <record>
    <record_id>1470124</record_id>
    <processid>BOM1525-10</processid>
    <bin_uri>BOLD:AAN3337</bin_uri>
    <specimen_identifiers>
      <sampleid>DHB 1011</sampleid>
      <catalognum>DHB 1011</catalognum>
      <fieldnum>DHB1011</fieldnum>
      <institution_storing>Marjorie Barrick Museum</institution_storing>
    </specimen_identifiers>
    <taxonomy>

You can choose to get the httr response object back if you'd rather work with the raw data returned from the BOLD API.

res <- bold_specimens(taxon = 'Osmia', format = 'xml', response = TRUE)
res$url
#> [1] "http://v4.boldsystems.org/index.php/API_Public/specimen?taxon=Osmia&format=xml"
res$status_code
#> [1] 200
res$headers
#> NULL

Search for specimen plus sequence data

The specimen/sequence combined API gives back specimen and sequence data. Like the specimen API, this one gives by default tsv format data, which is given back to you as a data.frame. Here, we're setting sepfasta=TRUE so that the sequence data is given back as a list, and taken out of the data.frame returned so the data.frame is more manageable.

res <- bold_seqspec(taxon = 'Osmia', sepfasta = TRUE)
res$fasta[1:2]
#> $`ASGCB261-13`
#> [1] "AATTTTATATATAATTTTTGCTATATGATCAGGAATAATTGGTTCAGCAATAAGAATTATTATTCGAATAGAATTAAGAATTCCTGGTTCATGAATTTCAAATGATCAAACTTATAATTCTTTAGTTACTGCTCATGCTTTTTTAATAATTTTTTTCTTAGTTATACCATTCTTAATTGGGGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAATTCCAGATATAGCATTTCCACGAATAAATAATATTAGATTTTGACTTTTACCTCCTTCTTTAATACTTTTATTATTAAGAAATTTTATAAATCCTAGTCCAGGAACTGGATGAACTGTTTATCCACCTTTATCTTCTCATTTATTTCATTCTTCTCCTTCAGTTGATATAGCTATTTTTTCTTTACATATTTCTGGTTTATCTTCTATTATAGGTTCATTAAATTTTATTGTTACAATTATTATAATAAAAAATATTTCTTTAAAACATATTCAATTACCTTTATTTCCTTGATCTGTCTTTATTACTACTATTTTATTACTTTTTTCTTTACCTGTTTTAGCAGGTGCAATTACTATATTATTATTTGATCGAAATTTTAATACTTCATTTTTTGATCCTACAGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT"
#>
#> $`BCHYM1499-13`
#> [1] "AATTCTTTACATAATTTTTGCTTTATGATCTGGAATAATTGGGTCAGCAATAAGAATTATTATTCGAATAGAATTAAGTATCCCAGGTTCATGAATTACTAATGATCAAATTTATAATTCTTTAGTAACTGCACATGCTTTTTTAATAATTTTTTTTCTTGTGATACCATTTTTAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAATTCCAGATATAGCTTTCCCACGAATAAACAATATTAGATTTTGATTATTACCGCCATCTTTAATATTATTACTTTTAAGAAATTTTTTAAATCCAAGTCCTGGAACAGGATGAACAGTTTATCCCCCTTTATCATCAAATTTATTTCATTCTTCTCCTTCAGTTGATTTAGCAATTTTTTCTTTACATATTTCAGGTTTATCTTCTATTATAGGTTCATTAAATTTTATTGTTACAATTATTATAATAAAAAATATTTCTTTAAAATATATTCAATTGCCTTTATTTCCTTGATCTGTATTTATTACTACTATTCTTTTATTATTTTCTTTACCTGTGTTAGCTGGAGCTATTACTATATTATTATTTGATCGAAATTTTAATACATCTTTTTTTGATCCTACAGGAGGAGGAGATCCAATTCTTTATCAACATTTATTT"

Or you can index to a specific sequence like

res$fasta['GBAH0293-06']
#> $`GBAH0293-06`
#> [1] "------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATGTTAGGGATTCCAGATATAGCTTTTCCACGAATAAATAATATTAGATTTTGACTGTTACCTCCATCTTTAATATTATTACTTTTAAGAAATTTTTTAAATCCAAGTCCTGGAACAGGATGAACAGTTTATCCTCCTTTATCATCAAATTTATTTCATTCTTCTCCTTCAGTTGATTTAGCAATTTTTTCTTTACATATTTCAGGTTTATCTTCTATTATAGGTTCATTAAATTTTATTGTTACAATTATTATAATAAAAAATATTTCTTTAAAATATATTCAATTACCTTTATTTTCTTGATCTGTATTTATTACTACTATTCTTTTATTATTTTCTTTACCTGTATTAGCTGGAGCTATTACTATATTATTATTTGATCGAAATTTTAATACATCTTTTTTTGATCCAACAGGAGGGGGAGATCCAATTCTTTATCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTTTACCTGGATTTGGATTAATTTCTCAAATTATTTCTAATGAAAGAGGAAAAAAAGAAACTTTTGGAAATATTGGTATAATTTATGCTATATTAAGAATTGGACTTTTAGGTTTTATTGTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------"

Get trace files

This function downloads files to your machine - it does not load them into your R session - but prints out where the files are for your information.

bold_trace(taxon = 'Osmia', quiet = TRUE)